GenePrediction:GLEAN_6283 Details

Name: GLEAN_6283
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1070359..1066295 (- strand)
Length: 4065
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1070359..1070201 (- strand)
Length: 159
Type: CDS
Source: GLEAN
Position: GCSC_144:1069539..1067970 (- strand)
Length: 1570
Type: CDS
Source: GLEAN
Position: GCSC_144:1067912..1067844 (- strand)
Length: 69
Type: CDS
Source: GLEAN
Position: GCSC_144:1066335..1066295 (- strand)
Length: 41
>GLEAN_6283 class=GenePrediction position=GCSC_144:1070359..1066295 (- strand)
ATGAGGCTTCTGCGCTGTACCGACGATGGGTTCACTCTGACAAAGGACTTTCGTCCTCACGAAGAGTGGCCGGAGTACGC
CATCTTGTCGCACAGATGGGGCCTAGACGACGAAGAGGTCACACATGCCGATCTGGTCAACAACGTCGGGGAGACCAAAG
TCGGTTATGAAAAGCTACGGTTCTGCGCCCGGCAGACGAAACAGGACAACCTGCTACACTTCTGGGTGGACACGTGCTGC
ATCGACAAAACAAACCAAGTCGAGCTGCAAGAGTCAATTATGTCCATGTTTTCCTGGTACAAACGTGCAGCCCGCTGTTA
TGTGTACTTGCCAGACATCGACGCTACGCGCTACAACCTCAACGAGCGCCGCGAATGGGAGCCGGCACTTCGGGCAAACG
AATGGTTCAGACGCGGCTGGACGCTCCAAGAGCTTATCGCCCCAGCCTCCGTCGAGTTCTTTACAATGGAAGGCCGGCGA
CTGGGCGACAAGCGGTCTCTCCAACAACTGATCCACGACACCACGACAATTCCGATTTCGGTTCTTCAAAACAGCGATCT
TTCGAGTTACGACGTCGAGGAGCGGTTTCGATGGGCCGAGTCTAGGCGTACGACGCGCGAGGAAGATGCGGCGTACTGTC
TCTTGGGCATTTTTGGCGTGTCTATGCCGGTCCTTTACGGCGAGACAAAGAACAATGCTGTTCGTAGGTTGAAGGAGGAG
GTTGCTGCGTCCATACAGCGTGGTGACTTGTTGCTGCACCAAGGTACGATCCCGTCTTCCTTTCCTTCTACCGCGTACTA
ACACCCGGCTGCTTATAGAGAAACGTGTTTGGACGGTGCCGTTTGATCGAAATCCTTGCTTTACCGGCCGCGATGATGAG
CTCAAAGCCATCCGTCAGATGCTCGTCGTCAAAGACCGAACGGCAAGGGTCGCCATCACGGGCCTTGGCGGCGTCGGGAA
AACGAATATCGTGCTCGAGTTGCTTTACCGCATGCGGGCTGAATACAAACATTGCTCGTTCATCTGGATTCCGGCAACAA
GCGAGGAATCCCTCTCACAAGCATACCTCGCGGCTGCTGAGAAGCTGGGCATACCTGGCTGGAACGATCCAAAGGCCGAC
GTTAAAAAACTGGTGCAAGCCTATCTTAGCAACGAAAATGCGGGTCAATGGGTTCTTGTATTCGACAACGCCGACGACCG
GACTCTGTGGCTTGAGAGGCCTGCGAATGATCCGCACTCGTCTCGTCTCATCGATCATCTGCCAAAAAGTAGCCGCGGGT
CCATCATCTTTACGACGCGTGACACAGGTCTAGCAGTGCAACTTGCTAGTCCGAACAATGTGAACGTATCCGATGTGGGC
GAGGCTGGCGGCAAGAAGCTGTTACGAAAATACATACATGAGCAAGAGCTTCTTCAGAACGAGGAAGACACGGCTGCTTT
GCTCAAGTGGTTGACATACCTGCCACTGGCCATCGTTCAAGCAGCAATGTACATCAATGAAATTGGATTAGACCTAAGCG
AGTACTTGTCGCTTTTGAATGACCAAGAGGAAGGCGCCATTAAGCTCCTTAGCGAGGACTTCTTAGACTACGGACGGTAT
TCTGACGGAAAGAACCCGATCGCCACGACTTGGCTTGTCTCTTTTGAGCAAATACGAAAGCGTGATAGTCTAGCGTCCGA
GCTCCTCTCTTTCATGGCTTGCATAGATGCCAAAGACATTCCGCGGTCACTGCTGGCACAAGATCTAGGGCGAAAGAAGG
AGGCCGATGCGATCGGAACACTCAAGGCCTTCTCCTTTATCTCGCAAAACCGCGCAAGCTCGACTTTCACTATGCATCGA
TTAGTGCACCTGGCAATGAGGAACTGGCTCCAAAAAGAACAGCTGCTACTTCCCTGGACCCAAAAGGCCGTCACGAGGCT
CGCGAATGTCTTGCAAAATCCCGATTACCATCATCGTGATATTTGGAGGTCGCATATGTCTCATGCACAGTATGCGCTCA
CGATGTCACGGGCGCAAGGCCTACACGTGGCTCAGGCACCCCCCCACATGTCCACGCATGCAAGGTGTCTTCATGGATTG
TTAGTCTCTTCGAAGATGCCTATTTCCTCAGAGCCCATGCCGACAAAACCGTCACACACAACAGGACTTCGTGAAAGCGA
TGGCACAGACAGACAGCGTCTGTTATCGGCTTACGGGACATGCCTCTATTACGATGGGCGATACCGAGACGCGGAAGCAG
CAAGGAAAGAGGTGATGGAGACGAGTAAGGCGAAGCTTGGAGCCGATCATCCCGATACGCTGACTAGCATAAACAACCTG
GCGTCGACGTACAGGAACCAGGGCCGGTGGGAGGAGGCTAAGAAGCTGTTTGTGCAGGTGATGGAGACTCGTAAGACGAA
GCTTGGAGCCGATCATCCTAACACGCTGACTAGCATAAACAACCTAGCGTCGACGTACAGGAACCAGGGCCGGTGGGAGG
AGGCTGAGAAGCTGTTTGTGCAGGTGATGGAGACTCGTAAGTCGAAGCTTGGAGCCGATCATCCCGACACGCTGACTAGC
ATGAACAACCTGGCTTATACGTGGTTTTATTAAAATAGACACGTTGAGGCTTTCACACTGATGGAAAGTTGTGTTTAACG
TCGTTAACAAGCTCTTGGTCTAACGCATCCTGATACACTCTCTTCTCTCCGATGCTTAGAAATAAGGAAAAGCCGAATAT
TACGCCTAGAAACATAAGACCTATAATAGAACTAGTTGAGTCTTTGGGAATTGGTTAGACAACAACCACCAACTTATCTT
CTATTTTCCCATGTTACTAATTGTGCAGTTCCAGCTTCTAGTACGAGAATTTCACGTATCTCGGAAGCACTGCGCATCCT
GTGAATTTCCCTTTATTCTGTGAACCTTATTTACTACATTAGGACCATTGTACATGCTTACGAAGAACAGCGCGTAACAT
TAATAAACTCGTTAAACACCGACTCGATGCCAAGAACCACATACTTCTGCGGTATATTTTGAAGTTATGAAATGACGTCT
TTAGTAGGCTTTTTCGGCCAGCCAAGTAGCGTACGGCTTATGTGGAAGGGCTCGTTTGAGAAAGAGACGGAGGACATAAA
TCAGTGCAGACAGCTTCGGCGTATACAAGGAAACTTCCACCAAAGAGTCCGTTGTGTCGGAAAGTGCCAAGACGTCATTG
AAGTACACAAAAATCATCGACTCGGGCTTGTCGTTTCGTGGCTTCTGTAACGGCTCAGGCTGGCGATGGCGCACCAAAAG
CTCATTTGATTCGACATGAGTAATCTTAAGGAACAAGATGTAACGGTTCACGTAGCTGAAGGCAGTAATCACGTGCGTCC
TCCCGGTACTCCTGTACGGCACAGACGTGTGATACACCAACCACAAAAAAACCCCTGCTTCCAGGGGACGGAGCTGTCAG
GGCAAGACAGTCTCGTCCCGCAAAAACTGGCACATCTAGCAGATCGACAAAGTCATCAATAGTGCCGCCCGGGCGGCTCT
CTAGTCTGGAGGACCACGCCCAACCTCGCGGTCATTCGAGATGTAAGTCTATCCAGTGCCGCCATTGCACTGGAACAAGT
CCGGATCAGACAAGCACTACGGCTTTCACAGTTTCCGGGGACTCATCCCCTGGCCCGCAGGACCAAGATACAGCTGAGCG
TGAGAGATAAAGGGCACGGCCGACCGGAGAAGAGAAGGACTCCCATCCAACTTCTGGCCGGCAGCGTACCCATCACTTTC
CCACGGCTGACACCAAGTCCCCCACACTTCTCCCCTGGCTGCCGGACTGACCCCACGCTGGGCCGGTCCAAGGAGGAGGC
CGATGGGCCCAGCTACAGCGGCGTCCGAACTGCTATGGCTAAAGCCTTCCGAGCGTTTACGGAAGACTGGTGGTCAAGCC
ACCAGTACAAGCTTTTCCTTCGTACAAAGAATGAGGCCTGTAGTACACGCTCAAAGAACCCCCAGAGCTCGCCCTCCCCA
GGACGGCTAAGCACAGTCACGGAGTTTATGCCCGGTACCACGACAGAGGCGAGATCTATCAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62