GenePrediction:GLEAN_6292 Details

Name: GLEAN_6292
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:992361..990066 (- strand)
Length: 2296
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:992361..992121 (- strand)
Length: 241
Type: CDS
Source: GLEAN
Position: GCSC_144:992000..991437 (- strand)
Length: 564
Type: CDS
Source: GLEAN
Position: GCSC_144:991359..990286 (- strand)
Length: 1074
Type: CDS
Source: GLEAN
Position: GCSC_144:990082..990066 (- strand)
Length: 17
>GLEAN_6292 class=GenePrediction position=GCSC_144:992361..990066 (- strand)
ATGGACCCCGTAACAGCAATCGGTCTCGCATCGTCCATCATCGCTTTCGTCGATTTTGGCTGGAAGCTCATAAAAGGTGC
AAAAGAAATATACGACGCCGCCGATGGCACTCTGGAGGAGAACCGGAGCCGTGAGGCTGTTGTCCTCGAGATGAAACGCC
TAACCGTCCAGCTTGTCTCGCCCGAGCACTCGCTTCTGTCTGGTGAGGAGAGAGATCTCTGTTTGCTCGCTGGCACATGC
CGTAAGCTTTCCGACAAGCTGCTCGATTGGCTGGAGCGGGTCAAGCCGAAAAATGAATAGTCCAAAATGCAGAGCCTTTG
GGCGGCACTGAAAAATACGTACTACGAAAGCGAGCGCGAAGATCTGGAAAAGCGCCTAGGCGCTTGTCGCAGTCAACTGG
CGCTGCACATTAATGCTACAACCATGTTCTCGATCGACAAGCTCTCCGAGTACGTCAAAGACAATGCCTCAAGCCTCAAG
CCGCTGAAGAAAGCCATGTCCCAGCTGTCTCGGATTGGTGCGGATACCCAAACGCAGGTTCGCCAGCTGTTGAATATACA
GAAAAACGCGCTCCATGCTATCATAAAGGCCCGAATCCTGGCAGGTTTAAAATTTGAGGGTATGCATGATCGTCATGATA
TGGTAGCAGAGGCACATGAAAAGACATTTCGGTGGATCTTCAATGTCGAAGGTGACGGCAATCAAGATATGCAGGGATAT
TCTGCCAAGACTCCGTACCGGCAAGACGATGCTACGAAAGAGGAAGCTGAACTCAAAGAAGAAGCACGAGAGAGATTCCT
ACAATGGCTATCGTCTGGATCAGGAATTTTCCACATATCAGGAAAGATGGGCTCGGGAAAGTCGACGCTGGTGAATTTCC
TGAGCGACCATCCGGAAACGGCGACGAGACTTGAGACTTGGGCAAGTGGGTTATCGTCTTGTTACTCCAACGAACTGCCA
TGCCGTACTGACTCCTTGCAGACAATAAACAGCTCGTTCTAGCAAGCTTCTTCTTCTGGCGGCCAGGCTCCGATATGCAG
AAATCACTCAGCGGGCTCTACCGTTCTCTCTTGCACGATGTGCTCAGCTTCTGCCCCGAGCTTATTCTTGATGTCTTCCC
TAGTGTTTGGCAGCGGGCAATGGAAACTCCTTACGACGGTCAAACTAAGGAATATTTTCAAGAGAGCGACATCAAAAATG
GGTTTAATGTCCTCGTCACTAAAGAGGAGCTATTCGAACATCATTCGTTCTGCTTCTTTATCGACGGCCTAGATGAATAC
CAGACCCCAGTGGATGCCGTGATCTCCGATATGGTTGGTGAGCTCTGCCGCTGGACGATCACCTCGCCGTCGAGTGTGAA
GCTTTGTGTCTCCAGCCGGGAGTATCCTGAATTTATGGACAAGTTTTCGCCGTCACAGCGGTTGAGGCTTCATACGCTGA
CACGATTCGACATCGAGGTATATGTCAGAGACAAACTCGGTCGCACAGAAGATAAGGGAATCGCGACGTTGACTAAGTCT
ATTGTCGAAAAGGCTAGCGGCATCTTCTTCTGGGTGTCGCTGGTGGTCAGACAAATACGTGAGCAGCTGGAGATCGGGGT
TGAGCCTGCTCGTCTTGTCGAAATTGTTAATGGCTATCCAGTTGGACTGGACCATCTCTACCGGCACATACTCCAGACAC
TCTCCCCTTACAGTCGCAAGAGGGCGTACCAGACGCTAACCATGATGCCGTTTGTAGGTGGTACCAGCGACAGTCTACCT
TTAGACCTTCTAGCATACTCCTTTCTCGACAAGTACAATGAAGATCCGGAATTCGCCCGGAAAGAGACATTCGATGCGGG
ACTTCCACAATTGAGGGCCTGCGAGGAGACAACACGATCCCAAGCCCGAAGCCTTTTAAATGGCTGGTGCCGGGGGCTTG
TCGAGGCTGACGAAAATGGCCACCTTGGCTACGCTCACCGCTCTGTGGCAGACTTTTTGGAGGCTGCGGACATCCGAGAA
CGGATGGCTGCCTCTGTCAACGGCTCTCATCCCGTCAGCATCTTCTCAGAGCTAATCCTGGCGCACTTGAAAGTTGGTGT
GCATCACGGATTGTCTTCGTGTTCGTTTTTCCAGCTGGTTGGCATACGTCACAAGTACAGCCTCGACCAGGCACCGTTTT
CATTTCTGCGCTGCCTAGATACGCTCAATGCAAACATCTGGGACATACTGGGTGATCCTTTGGCCACAAGCGAGCTTGCT
GTGCCAACTGCTAAGCACTGCGGGAGCGTACTTGCACAGACAAATATGCCTTCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62