GenePrediction:GLEAN_6294 Details

Name: GLEAN_6294
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:981753..978085 (- strand)
Length: 3669
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:981753..981693 (- strand)
Length: 61
Type: CDS
Source: GLEAN
Position: GCSC_144:981615..979465 (- strand)
Length: 2151
Type: CDS
Source: GLEAN
Position: GCSC_144:979079..978946 (- strand)
Length: 134
Type: CDS
Source: GLEAN
Position: GCSC_144:978846..978085 (- strand)
Length: 762
>GLEAN_6294 class=GenePrediction position=GCSC_144:981753..978085 (- strand)
ATGCTCGGCTGGGCGCTGAAGCGCAGTCTGGGAGGAGGACGCGACGCGCCGGAAGACGCAGGTGAGGAACAACGCGCCCA
GAAATGAATCTATCGGATAAGAGTCCAATCTGACCCAGTTCTTTTGTATTCTGTGTAGACGACACGCAGTTGGAGCAGCC
AGACACCCCGGCGCCCGTTTTTGCAGCACGCGCATTCAAAAGCGCTCTGTTCGGAACGCCAGTACGGCGAGACGACAATG
CCAGGCGGCAGCTTGCGGAGAAACTCAGGGCCAACACCACTGTAGTCTCGATCGTGCCGCAAGGTTCTTTCGAAGGCCGC
ACGTCGACAGATGAGAATGGCAACAAGAATGGGCCGGACACAAAAGGCACTCCGCGAAAGCTGGCCGGGATTCTCCTGAC
GCCAGGAACGGCAACGTCACGTCGGAAGCGAGTCTCGTTTGGGCGCGAGGTTGAGGCCGGCGAGAACGACAAGAAGAAGG
AGCTCAGGATCGACAGAGACGGGCGCGGGCGCGTGAATCTGTTTGGCGACTCGGACGTCAAGGCGGCCAGCGAGCGGTCG
CGCGCCCGACCACGCTCCAAGCTAGCTCTGGCTCTGGAGAATGCCCACCGATCGGGGGCCGAGACACGGAAGGAAGTGAT
GGATGAGCAGACGGAGGATCTTCAGGCTCGCCTACAACAGGACACACAACAGGCTACGTCCACGACGGCGGCACGGGGGG
GCGAGGAGGAGGAGGCTCTTTGGGAGGAGGTGGACGATGTCGAATGGGACCCGGATGTGACAGTCGACCTCAATGAGCCA
CACTCGCAGTCAGGACGATACTGGAAGGCGCAGTTCCAGCGGTATCAGGAGGACGCCAAGGCGGAGATGAGCAAGCTGCT
CAAGTACAAGCAGCTGGCAAAATCGTACGCAAAGATGAAGGACGCGGAGTCGATGGACCTACACGCGAAGCTCAAGGAGG
AGAAGGACAAGGTGGCCAAGATGGAGAGTCACATCTCGGAGTTGGCGCGGCAGATTGCTCGCGGGCGGATGAAGGGCAGC
GACCACGACTACCAGGAGCTGATCACGGATCTGACACGGGAGACGGCGCTAGCGGTGCAGTACCGCAACCAAGTTAAGGA
GCTGGAGGCGATGTTGAAGGGCAACGAAGCGGGGAACCTGTTGGGCTATCAGGATCCAGAGGACCCGGTGAGCCCGAGCC
CGGCGCCCGGACGGCGACGTCACCAGCAAGCGGGATTGGGGCCGTCGCCTCGCACGCACCGAACGCTGCTGGAGACGCAG
CGAGAGCTCCGACGGGCAAGGGACCAGGCGAAGGACCTGGTGCAGGCTAAGGAGGAGGCGCGGCAGCTGAAGAGCGAGCT
GCGGGCAGCGGAGCAGCGGGCACGCAAGTACGAGAACGAGAGCAAGGCGCTGGCAGCCGAGCTGGCGTCAGCGGAGGAGA
CGGTGCAGGCGGCAGAGGCGAAGACGCAGGACCTGGAGAAGCGGGCCAAGTTTGCAGAAGAGGAGCGGCGACGAAAAGAC
GAGGCACTGCGGCAGCTGCAGCGACGATACGACTCACTCAAGGACGACGCCAAGGCGCGAGTGGGAGAGGCCGAGCAGGT
GCTACGGCGGAAGAACGACGAGATTGCCGAGCTCAAGGAGAAAGCGGCCCGGAGCGAGGAAGATATGGTGGTGAGGACGA
CAGCACAGACGATGCGGCGTCACGAGTCGGTACGAGCATCAAAGCGTCGGACAGCAGAAGCAGAGGACGATTTCGCGATC
CGACTAGACGACCTGCACGACGACACGATGGAGGAGCCAGAGCTGCCGCGACAGCGTCTGTTGGGGAGCAACAAGGAAAA
CGAGTGTCAGCAGGAGCAGCAGGATACATTTGCGGCAGCAAGAGCGGTGGCATCACGACGGCGACCCAAATCGATGACGT
TTGAAGACAGCGCGGGCGCTGGCGGGCTTCGGCGGCGACGGGGTGCCGATGCGCTGCGCACGATTGACCAGCCGCGGGTA
GACGAGCGTGTGCGGTCAGCGGCAGCGACGGCGATGGTAGCAGCCAAACGGTACTCGTATGCTGGGGGTGACGAGCCAGA
CATTGACCTTCTTGGGAACCGGTTTGCGCGTCTAGGCGAGACAGCCGGCGAAGCCGAAACCAAGAGGGAGGAGACGGAGC
AGCTCAAACACAGGCAGCATATGCACCTGGCGGCGGCAGACACGCCACGGGCTTCGATATCATCGGAGCGCGTGGCGGCA
GCTCTGGCAAGGGTGGAGAAGAGGCGGGCAGAGCGGCGACGAACGTTGGGTTCGATGCGGAACAGAGATATGTAGGAGAG
GAGAAGGAGCTGTGGGTTTTCTGGATTGTGTTATGGCGCCGGGTTGGAGAAGGTCTATTATTGGGAGGCTATCTCTAGGA
GAGAAGCTAATTCTGGGAGAAGCTTGGGAGAAGCTTTTTGTACGAGTGGAGGATATGAGAGAGAAAGAACCTTTGCGACT
GTGTTTGGTCGCCGCTGTGTTTTTTAAGCGAGAACTGTTTCCTATTAGTGGCTGCTTTAGTAAGCCAGCCAGCCCGAGAT
ACCTATAATTTGCGGGCGCTGCCAGAGAGCAGCAACTGCCTGTTGAATTTGCGTCAACGCCATCCTACCGTCTGCGCTTT
TTGTGTGCTCACTTTGCCGCGATGGGCTCGACAGCAGACAGCGTGCTGCTGGTGCTGGGTGGTCCTGGTGGCAGCGCCGA
TGAAGGGCTTGCAGCGGTCGACCAGGAGATTGCCGATCTGGAGGCGCGTCTACGAGCGGCCAAGCAGCGACGGGCAGAGG
GAATGGGTGTAGGTATGGCTGCGAGAGCAGATGGAGATGGAGATGGAGATGGAAGTGCAGAGGCAGAGACAGAGGCAGAG
GCATCATCGACGCTCACAACGGCACAGCACTTTTACCTATTGCTGTCGGACTCGGCGCTGCCACTGGGCTCATTTGCCTT
TAGCAGCGGACTCGAGTCGTTTCTGGCACACAGCAAGACGCAAGGCCATCGAGCAGGCGATGCCGCATCGCTGGACCGGT
TCCTTCCGCTGTCCGTGGCATCGTATGGCGCAGCCAGCCTGCCGTTTGTGTTGGCAGCGCACGATGCGGTGGGGGTGACG
AAGACGATGACGACGACCCTCTCTGACAGCCTCGCACAGCTTGACGACATATACGACGCCACTATCATCTGTACTGTTGG
TCGGCGTGCCTCCGTGGCCCAGGGTCGCGCCCTGCTGTCGGTATGGGAGCGAGCCTTTGCACCGGCGCTGGTGGCGGCCG
GCCAGACGGATCCGCTGCGGCTGTTTGCGCAGCTCGTCAAGGGTACTTCATCTTCATCCACTTCCATCCTCGATGCTGCT
CCGTCTCCTCACCTCCCGCCGCTCTTTGGCGCCGTGGCCGGACTCGCCGGGCTCGACCGCCGCCAGACGGCCGACGTGTT
CGTGTTCGCCCACGTCCGGGCACTCGTGTCGGCGGCCGTGCGCGCCAGCCTGATGGGCCCGTACCAGGCACAGCGGCTGC
TCGCATCAGAGCGCGTGCGCGTGCTCGTGGCCGCGGCCGTCCGTCGGTCGTGGGCCGTGGCCGTCGAGGCTGCCGGACAG
ACGGCACCGGTCGTGGACCTCTTGATGGGCCGGCATGAACTTTTGTACTCGCGGATCTTCAACAGCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62