GenePrediction:GLEAN_6295 Details

Name: GLEAN_6295
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:977672..976340 (- strand)
Length: 1333
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:977672..977644 (- strand)
Length: 29
Type: CDS
Source: GLEAN
Position: GCSC_144:977587..977559 (- strand)
Length: 29
Type: CDS
Source: GLEAN
Position: GCSC_144:977502..977488 (- strand)
Length: 15
Type: CDS
Source: GLEAN
Position: GCSC_144:977433..977409 (- strand)
Length: 25
Type: CDS
Source: GLEAN
Position: GCSC_144:977357..976340 (- strand)
Length: 1018
>GLEAN_6295 class=GenePrediction position=GCSC_144:977672..976340 (- strand)
ATGGTGAACATTACGGAAAAGATCAAGGAGTGCGTGGTGGCCAGACGACTCGATGGCAACGCTAGCATGTGCTGACGGAG
ACCAGGATTGAGGATGAGATGAAGCGGACGCAGAGTGAGCCAGGCCGCGGAAAAAGTCTGCGGAGAAGTGCTGACGATAT
TCATCTGCAGAGAACAAGGCCACAGGTAAGACGGTGGACTGTCTTCTTGTCTAGCTGTATCACGAGCTAACGGCTGCAGA
GTACCATCTCGGGCTGCTAAAAGGGTGAGTCGGGAGGCGGACACACGAGACGACGACATGCTCACACGACGACAGAAAGC
TGGCACGGCTGCGGGCGCAGCTGCTGGAGCCGGGACCGGGATCGGGCGGCGGACCAGGGGCGGGTTTTGACGTGAGCAAG
AGCGGAGACGCACGAATCGCGCTGGTGGGCTTTCCATCGGTCGGCAAGTCGACATTCCTGTCCAAGGTGACCAAGACGCG
ATCAGAGGTAGCAGCATACGCGTTCACGACGCTGACAGCGATCCCGGGCGTGCTGTCGTACGGCGGAGCAGAGATCCAGC
TGCTGGACCTGCCGGGGATTATCGAGGGGGCAGCCGAGGGAAAAGGACGAGGCCGACAGGTGATCTCAGCAGCCAAGACG
AGCGACATGATCATGATGGTGCTAGACGCGACCAAGAAGGCAGAGCAGCGGGCACTGCTGGAGGCCGAGCTCGAGGCGGT
GGGCATCCGGCTGAACCGGGAGCCGCCCAACATCTACCTCAAGGCCAAGAAGGCAGGCGGGATGAAGATCACCTTCACAG
CACCACCACGACACCTGGACGAGCGCATGGTCACCAACATCCTGCGCGACTACAAGATGCTCAACTGCGAGGTGCTCGTG
CGCGACGACGGCGCCACGGTCGACGACCTGATCGACGTCATCATGCGCGACCACCGCAAGTACATCCGCTGTCTGTACGT
CTACAACAAGATCGACAGCGTCTCGCTCGAGTTTCTCGACCAGCTCGCGCGCGAGCCACACACGGCCGTCATGAGCTGCG
AGCTTGATCTCGGCCTTCAGGACGTCGTCGCCCGCTGCTGGCAGGAGCTGCAGCTCATCCGCGTCTACACCAAGCGCAAG
GGCGTCGATCCTGCCTTTGACGATGCCCTCATCGTGCGCGCCAACAGCTCCATCGAGGACGTCTGCGACCGCATCCACCG
CACCCTCAAGGACACCTTCAAGTACGCTCTCGTCTGGGGCGCCAGTGCCCGCCATGTGCCCCAGCGCGTCGGCCTCAGCC
ACATGGTCGCCGACGAGGATGTGGTCTACATTGTCAGCGGCTGGAAGGCCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62