GenePrediction:GLEAN_6296 Details

Name: GLEAN_6296
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:972144..968939 (- strand)
Length: 3206
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:972144..972049 (- strand)
Length: 96
Type: CDS
Source: GLEAN
Position: GCSC_144:971966..971865 (- strand)
Length: 102
Type: CDS
Source: GLEAN
Position: GCSC_144:971795..971421 (- strand)
Length: 375
Type: CDS
Source: GLEAN
Position: GCSC_144:971367..970485 (- strand)
Length: 883
Type: CDS
Source: GLEAN
Position: GCSC_144:970422..968939 (- strand)
Length: 1484
>GLEAN_6296 class=GenePrediction position=GCSC_144:972144..968939 (- strand)
ATGAAGACGTCCCTTCCTCGCAAGTTCATGAGTTTGCGGGACAAAAACGGCACAATTCACCGCCGGAGCAAGTCGTCAGA
TCCTCAAACCCACAAGGTGCGCCTTTAAACGAGTCTCGGAAGCTCTTCGAGCTTGGCTTCGACGTCGTCCCCTCCAACCA
CTAACCTTGTCTCTGCAGAGCCGGCCGCATTCTGCTGACGTCTTCCTGTCCTATTTCAAAAGCGATGCCGCCAAACAGGC
TGCCCGAGCAGAGGAGGAAAAGGGAAAACAGGCTGCAAAGGTACCTCACCGTTCCCCCCTCTCTCGAAGCCTTGATCATA
GACAAACTCTGACAACAGACTCTACACAGCTCGACGAGCTTCGCAGCCGCCTGGACCAGCTTCATTTCACAGATGTCGCC
AAGGAACACCTCGGCTATGTTCTGCGATCCAAATACGCGGACGGCGATGTTGATAAGGCCGTCGAGCTGATCCGCCTCCA
GCGGGACGCCTTCGCTGGCGTCGTCCTTCCGTACAACCCCAACTCCGAGATGAAGGGCGCCGAAAATAGATTCAACGTCA
CCTGCTACCTCGACGCTCTGCTCTTTGCCATGTTCGCCAAGCTCAGCGCCTTTGAGTGCATGCTCAAAAACGAACTGCCC
GACGGCCCTCCTCGAAAGCTAGCTGCCCTCATCCGTTTATGGGTTAACATGCTGCGCACCGGTAGACTCATCTACGCTGA
CATGGTAGGTGCTTACACTTTTCCATCTTCTTTGAATTCTCGTTGATTTCAGTCTAGGCTGCAGGCCTACAGGAGACCCT
TGCCGACTGTGGCTGGTCAGACGCTCGTCTGGCCGAGCAGCAGGACACGTCAGAGGCCTTCGCCTTTATTACCGAAACCC
TACAGCTTCCGCTTCTCACTCTCCAGGTCGACCTTTTCCACCAGGGCAAGCGCGATGAGGATGACCACAAAGTCGTCTAC
GAGCGTTTGCTCAACCTGGCCGTGCCGCCCGATCCCGACGGCAAGGGAATTAAGCTGGAGGACTGTCTAGAGGACTACTT
TAACACCAAGGTCGATGTCTTGCGAGACAGTGCCATCGACAAGAAAAGCCTCGACAGGTCCTATACAACTCCTACGTCTG
CCGTCTCTCCCATAGAATCTCCTGAACCGTCCATGTTCACCGCAGCAACTCCAGGGCCCAAGGCTGTTTCGCCGGTCAAG
GATTCTATGGGCATCGATACATCCGAAGTGGTCACAGTCACAGCTACAGCCACCAGTCAAGAAGCAGCGGTCTCTGCCAC
GGCTACGATAACAGCGCCGTTCCTTGGAGATACCGTTCGGATAGTCCCCTCCGAAGACGACGCCGGGAGCAGCCAGGAGA
GCGCCGAGAGTGTAAGCGAAGCTCTCGACGACGACCCAGCGCCGCTGCATCGTAGGTGGACAACTTCGGAAGCGTTTGTG
GCAGCCTCTTTGAGCGACACTGCTTCTTCTTCGTCCGCCGACCCCCGCCTACCGCTCATTGGCCGCCAGCGGTCGGCTAG
CATCATTCAGCGCATCGCTCTTACGGAGGCGAAGCCGGCAAACATGGATTCTTCGAGCATCATGCAACAGTTTAAGCGCC
AAGGTTCTACTGTCATCAAGGCCGTCACGATCCCTGCATGGCAGATCTTCAGGTTGATCCGTAAGTTGCTTCGTATAAGC
CCCATATCCAGTCCTTTTGTGTCCATTTTAACCCTGCCTCAGCTTGGCATGCGGCTTCGGACAACGAACCGGTCAACGAC
ATCGAAGTGGCCCGCCAATTCAACAAGCGTCCCGTGGTTGGCATATGCCTCAAGCGCTACATGATGACAAATGGTGGCCA
ATTTCAAAGGCAGAACACCTACATTGACATTCCTGACAGCCTTCGTCTGCCATACTTCATGATGGCGGCAGATGGTTGTA
GTGATGGACTTAACGACCTTAACTTTGAGTATAAATTGGTCCTCCAGTCCGTTGTCTGCCATCGGGGGGTTTCTCTGCAC
AGCGGCCACTACATATCTTTTGCAAGGGTCAATCCCAAAACTCTCACCGACAACCGTCGCCACGAGCTCGACCCTCCCCC
AGACTACGAAGAGGAGCAGTGGGTGAAATTTGACGATCTTGATGTGGAGCACCGCGTGACCTATGTTGAAGACATCAAGG
CTGCTCTCAAAGACGAGATGCCATACTTGCTCTTCTACCAGATCATGCCAATGGTCGACCTGACTCCAACGACGACCTCG
AACGCTGAGAATAACCGGCCGCCCTCTTACACCGACTCGACAAGTAACATAGGCTACGCAAGGCCAGAGAGAACCCTTGG
TGATACAGACTTGGAACAGAGTGAGGTTGACCTGGCAGAATCTGGTACGGCTGCGGGAGCCAGCAGCCTCTTCAGCAACC
CTCCTACTTTTGTGGGTTCGACGACTGGACCCAGCATTCGCTTCTCATCCGATCTAGACGCACCGCCATCTATAAGTTTG
TATGAAGGGTCGAATGCGTCTTCGTTTGTGCTCACAGCCGCTCGCAAGTCGGAAAGCATCTCCCGCCGCGGAAGTATCGT
GTTTGCCGACTCTATCTCGAACACGCCGGCCATCACTCCAGAGGGTGGACGATCGCCTATGGTAACGCCACGTGCTACCC
CCGAAGAGACACCTGCACAGCGCTTTTCGCGCGCGGCCGCACGCCTTGCAGCAAAGTCCCGCAGCCGCCCGGTAAGCCAG
GCTGGAGAGGGCCGCATCAGCCTGACGATGACCCGCCTTGGCGGACTCATGCGGCCGAGCAAAGAGCCTTTGCGCCAGTC
CGAAGACAACTTGGACGGCGGTCTGGGCACAAGTCCACTTTGCTCAACAGCAAACCCGAGTGCTATAGCAGCTTCTGACT
CGCTGTTACCCCCCAACCCTATCTTAGCCAACGTTGTCTCTGCACCGGCTGCCTGCCCGCCAGGCGAGCAAGTGGCTACT
ACGCTACCGACAGATTCTCCATCTCAGGGTCAGCCACAAAAAGAAGCACAACTCCAAGCAGACGACGGTCATCATCACCA
TCATCATCACGGGCTGCGGCGAGGCAAACCCAAGCTCCGTGTAGAGCGGGAATCCGACGAAGAAAATACCGGTACAGGTG
CCGGCAAAGGCAAGGAGGCAGAGAAAGAAAAGGTCCGAATCAGGACCAAAATGAACGTGCCGGAACGCGAGTGCGTTGTC
ATGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62