GenePrediction:GLEAN_6297 Details

Name: GLEAN_6297
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:964493..963540 (- strand)
Length: 954
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:964493..964237 (- strand)
Length: 257
Type: CDS
Source: GLEAN
Position: GCSC_144:964128..963540 (- strand)
Length: 589
>GLEAN_6297 class=GenePrediction position=GCSC_144:964493..963540 (- strand)
ATGATCAATCCGCGCGTATTCGAATCGCTGCGGGCTCGCGCCGAGCAGGAGACCAGTGCCCGGGCGGCGATTGATGGACT
CGTGGAGGCACTGGAGCGCAGCGTGGCCTATGCCCAAGGCGTGTTGTCGCGGGTTCACGCAACGCCGCGAGCTCGATACG
CCGACCTTTTGCTGCCGGCGGCCGAGGCGGCGGTGGCTGACGAGACGGCGAAGATCCGGCAGCTGGCCGAGGTGGCATCA
GCGCACCCATACTACAAGTGAGAGGAAGCGGGTGTTTATGCAGTTTTTTGCAATTTTTGCAATTTTCCTTTTCTTTTCCG
GATTCGTTTTCTGTTTCCTGTTCCCTTGTCCTCGCTGACAGCCAGATTTAACAACCGCTGGACACGACACCTGCAGGACG
CCATCGCGACGGTGCTGTTGACGGCATGGCTGGGCGGCAGTGTGGGTGGCAGCAGCGGTGGCAGCACAGATCCTGGCGAG
CTCGGCCGGCTGCTTACGCTGGAGGAAGTGGGCGAGGCGCTTGGTGTGCCGGTGGACGGGCCGGTCGATGCGGCGGCAGC
ACAGACGGATGTGGATGTCGGCGCGGAGGACCGGTTCCACGTGGCGCTCGACGAGTACCTGTCAGCGCTGACGATGCTGG
CCGACGAGCTGGGCCGACTGGCGATGAACGCGGTCACGCTTGGCGACGGGGCGCTGGCCGTGCGCATCAGCCGGTTTGTC
AAGGAGCTGCACGGCGGCTTCCAGCTGCTCAACCTGAAGAACGACTTTCTGCGGAAGCGCGTGGACGGGGTCAAGTACGC
GGTGAAGCGCGTCGAGGGCGTCATCTACGACCTGGCGCTGCGGAACCTGCTGCCAGCTGAGGTGGGAGCGGAATCGGAGG
ACGGCGAGACCAAAACCGTAGCTGCTGCTACGGCTGCAGAGAAGGCTACGGACAGCAGGATGGGCGAGGCTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62