GenePrediction:GLEAN_6298 Details

Name: GLEAN_6298
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:963177..962205 (- strand)
Length: 973
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:963177..962695 (- strand)
Length: 483
Type: CDS
Source: GLEAN
Position: GCSC_144:962630..962205 (- strand)
Length: 426
>GLEAN_6298 class=GenePrediction position=GCSC_144:963177..962205 (- strand)
ATGCCTCTCGTCGACCCTGTCACGATGTCGTCTGCTACTGCAACGCCGAACCGTCGTCGACGAGGCGGCCCGTCGGCCAA
GAGCAGCTCGCACGACGATTCTATCACCACCACCAAAAGCGCCACCAACAGCAGTCTCTCTGCATCGTCGCCATCTTCCA
CGCCTCCGGCCTATGCCACCTCGCTCGCCCTGGCTTCCCGACACGGCAGCCCGTTGCTGCTGCTGGCTGGCCTGGCCCTA
AGCTTTGGCGGGTTGGTGGGCAGTGGCCCCACGCAAGACAGCAGTAACAGCACCAACACTACCACCAACACGACTGAAGA
CGGCTATGGCACTGGCATCGGCGCGCTGGCCGGCCTGCTGGTGGCCTCGACGGTCGTGCAGGTGGCTGCGGCTGTGATTG
GGCTGCCGCCAGCAGGTTCAGACGCCGAGTCGCAGAAGAAGCGGCGGGCCCGCAAAGACCAGCGCAAGCCCAACGTCATT
GTGGTATGTTCTCTCGTCGCTGTCCTTTCCGGCCGTTTCTCGGTGTCCTGACTTCCTTCCGCCATAGACGACCTTTCTCT
CCCTCCTGCTCACCGTTCTCGCCGTGCCGCTCGTCCACGTCGTCCTCGTCCTCTTCGGCGCCCCCTTTCTCGTCCACGCC
CCCAGCACTCTTCTCTGTGCCGGCCACATCGCCGTGCTCGGCCTCTTCCCCGTCGTCTTCACCCACGGTACCGACAGCCC
CGGATGGCTGGCCCTCATTTCCGGCGATTTTTTTTCGGCGGCTGCCAAGGGCGGCCTCTCGGTCGCTGACGCTGCTTCTG
CCGCCGGCCTCTGGGGCACCTGCATCGGTGCCTGGCTTGGCGCTGTGCCCATTCCACTCGATTGGGACCGGCCGTGGCAG
CGCTGGCCCGTCACCATCGTTGTCGGCGCATATGTCGGCCACGCCGTCGGCCGCCTGCTGGGAGGTGCTCTGCAGCAGCA
GCGGAGAAGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62