GenePrediction:GLEAN_6299 Details

Name: GLEAN_6299
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:949778..948284 (- strand)
Length: 1495
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:949778..949608 (- strand)
Length: 171
Type: CDS
Source: GLEAN
Position: GCSC_144:949539..948385 (- strand)
Length: 1155
Type: CDS
Source: GLEAN
Position: GCSC_144:948313..948284 (- strand)
Length: 30
>GLEAN_6299 class=GenePrediction position=GCSC_144:949778..948284 (- strand)
ATGCCTCGTGACCCACTTATAGGACTCGTCGGCAAGCCGAGCGCTGGCAAGTCCAGCATGCTCAATTCGTTGACGGATGC
ATCATCCAAAGTCGGTTTGTACACGTCCTCAAGCTCCCCGCCGAAAGAGGAGCACTCGCTTACGCAACCTCTCGCCTGTA
GGAAACTTTCCGTACGCTCACGCTCACTCTCCCACCCTCTCTTTCTCCGTTTCCTGTCCAGCCTTATCCGTCCTAACAGA
CGCTCAGATTCACCACCATCGATCCTCAACGCGCGGTCGGTTACCTCCAGGTAGACTGTGCTTGTGCCCGGTACGGAATC
TCTGACCGCTGCAAACCGAACTACGGCTCCTGTCACGATGGGCGCCGCTCTGTGCCGATCGAGCTGCTTGACGTCGCCGG
TCTTGTCCCAGGCGCACACCAAGGCCGCGGTCTCGGCAACAAGTTCCTAGACGATCTGCGCCACGCGGATGCACTGATAC
ACGTAGTGGACGTCAGTGGAACCACGGACGCCGAAGGCAAGAATACGCGCGGCTACGATCCCTCCGTTGACATCGCATGG
CTGCGGTCTGAGATCGTACAGTGGATCAAGGGCAATTTGATGGAGCGGTGGGGGAGCATCCGACGACGCCACGTGGCTAC
CAAAGCGGCAGCGGCCGACACGCTGCAGTCACAGCTGTCGGGCTACGGCAGCAGCCCAAAGTTGATAGCACGCACGCTGG
ACCGGCTGGCTCTGCGCGAACCGTTAGAGGAGTGGGACAACGCAACCATTGACCGCGTGGTCAACGCCTTTATCGACGAA
AAATTTCCCACTGTAATTGCGCTCAACAAGATCGACCACCCCGATGCGGACCGCAACATTGCCAAGATCACCAAGCTAAA
CGACCCCAACACCGTGGTGCTCTGCTCTGCCGTGTCCGAGATCTTCCTCCGCAAGATGGCCAAACAGGGGTACATCCGCT
ACACCGAGGGCGGAGAATTTCTGGATACGCGCGAGGACTTGCTGGCCGATGGCGACACCGAGGGTGCAGAGCAGCTCAAG
GAAATCGACGAGAAGAACTTGCGCCGTATCAACAACCTGCGCGACATGGTCATCTACCGCTTTGGATCTACGGGTGTCGT
GCAAGCACTGACCAAAGCGGCTGAGGTGCTCGGACTCATTCCCATCTTCCCTGTGCGCAGTATATCGGCATTGAATACGG
CCAGCGGGGCAGGATCCACGGCGCCGGCAGAGGCCGCTAAGCCGGTGTTCCGCGACTGCGTGCTAGTTAAAAGAGGCATC
ACGGTGGCCGATGTCGCGCGGAAGGTCATGGGCGACGCTCCGATCGCGTTCGTGGAGGGTGCAGCTGGCACGCGTGTCGC
TGAGGACGACACGGTGGATGTGGGTAAAAACGACGTAAGCGTTACTATTTTAAGACAGCATACTTGGTTCAAATCTGTCT
ATCTTACTAACCTTTTCCTCTGCAGATTTTGTCTTTCAAGGTTGGGCGAGCATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62