GenePrediction:GLEAN_629 Details

Name: GLEAN_629
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1096127..1096771 (+ strand)
Length: 645
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1096127..1096291 (+ strand)
Length: 165
Type: CDS
Source: GLEAN
Position: GCSC_97:1096361..1096531 (+ strand)
Length: 171
Type: CDS
Source: GLEAN
Position: GCSC_97:1096595..1096771 (+ strand)
Length: 177
>GLEAN_629 class=GenePrediction position=GCSC_97:1096127..1096771 (+ strand)
ATGCCTGAGGAAAAGTCATTCGAGAAGATCCCGCTGCAGAGCAACGACGGCACTGTGATTGTAGTCGACTATGACGTTGC
CACGCGATCAGCACTCCTCAACACCATGCTGGACGATCTTAAGGGAATGGGCGTTAGCGACCTCGGCCCTGTTCCTCTAC
CGAACGTACGGACTGTGCTTTTCTAGATGCAACTTAATAACCCTTCAATCATAACACTAACCACTTCGCTTTAGGTTAAC
GAGGCTGTCCTCCGCAAAGTCATCGAGTACTGTGAACACCACCGTCACGATCCTCTCGCCGGCCACGAAGAAGAGAGCGA
GAACCGCAAGAAGACCACAGACATCGAGGAGTGGGACCAGAAGTTCATGCAGGTTGACCAGGAAATGCTCTTCGAGATCA
TCTTGGTACGTTCATCACATTCCCCACCTTTGAAGCCGGTGAGGACATTACAACTAATGCAAACACAGGCTGCCAACTAC
ATGGACATCAAGAGCCTTCTCGACGTTGGCTGCAAGACTGTCGCGAACATGATCAAAGGCAAGTCTCCTGAGGAGATTCG
TAAGACTTTCAATATCACCAACGACTTTACTCCGGAGGAGGAGGAGCAGATTCGGCGGGAAAACGAATGGGCGGAGGACC
GCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62