GenePrediction:GLEAN_6302 Details

Name: GLEAN_6302
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:929189..926802 (- strand)
Length: 2388
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:929189..929056 (- strand)
Length: 134
Type: CDS
Source: GLEAN
Position: GCSC_144:928994..928868 (- strand)
Length: 127
Type: CDS
Source: GLEAN
Position: GCSC_144:928807..927390 (- strand)
Length: 1418
Type: CDS
Source: GLEAN
Position: GCSC_144:927327..926802 (- strand)
Length: 526
>GLEAN_6302 class=GenePrediction position=GCSC_144:929189..926802 (- strand)
ATGGATCGTCAGTCGGTCTATTCTACCCATGTCTACGACTACAACGAGACAGGGGAGGAGACTCGAGTAAAGACCCGGAA
GGATCTGGAGGATTTCATCCTCAAGTTCCGGCTCGACAATGACTTCGTTTACAGGTACGGTCATGTGAGATAACAAGATA
GGGCGAATATGGTTGCTGACTGGGCCTTCCTGCAGAGAACAATTGAAGGAGAATGCCCTGCTGAAGAAATACTACTGCGA
CATTGACATTGGTGACTTGATCAAGTACAACGAGGAGTTGGCGCACCGACTGGTTACCGAACCGGCCGAAATTATTCCCT
TGGTATGTTGGCTGCGTTCGGGCAGAGGAGAAAGACAGAAACGCTGACAATGCGTCTGATAGTTTGAGAATGCCCTCAAG
CGATGCACCCACCGGATCGTGTTCCCACACCAGAAAACGGTAGACCTGCCAGAGCACCAACTTTTGCTGCACTCAAGTGC
AGAGGAGGTGGCAATCCGCAACTTGGATTCGCTGACGATCTCGCGGTTGGTGCGGGTGCCGGGGATTGTGATCGGGGCGT
CCGTGATGGCGTCGAAAGCGACAGACCTGGTAGTACAATGCCGCGGCTGCGGGTTTGAGCAGAGACTTCCAGTGACAGGA
GGGTTCACGAGCGTGACGCTGCCGCGGCAGTGCGGTCGGCAACCAACGCAGGGCGAAGGCGAGAAGTGTCCGATGGACCC
ATACTATGTGCTGCATGAAAAGTGTGGGTTTGTGGACCAGCAGGTGATCAAGCTGCAGGAGGCGCCAGAGCAGGTGCCGG
TGGGCGAGCTGCCGCGGCACGTGCTGATCTCGGCGGACCGGTACCTGACGAATCGAGTGGTGCCGGGGTCGCGGTGCACG
GTGACGGGCATCTTCTCGATCTACCAGAGCAAGAACTCGTCACGGAGTGGAGGCAGCGGATCAGCAGGCGGCGCAGTGGC
GATCCGGACACCATATCTGCGGGCGGTGGGGATCCAGACGGACCTGGACCAGACGGCAAAGGGCCAGGCGATGTACACGG
AGGAGGAGGAGCAGGAGTTCCTGGAGCTGAGCCGGCGGCCAGACTTGTACAACATCATGACGGACTGCATCGCACCATCG
ATCTACGGCAACCGAGACATCAAGAAGGCGATCCTATGCCTGCTGATGGGTGGGTCGAAGAAGATCCTGCCCGACGGAAT
GAAGCTGCGTGGCGACATCAACGTGCTGCTGCTGGGTGACCCGGGAACGGCCAAGTCGCAGCTGCTCAAGTTCGTGGAGC
GAGTTGCGCCCATTGCGATCTACACGTCGGGCAAGGGATCGTCGGCGGCGGGTCTGACGGCGTCGGTGCAGCGGGAGCAC
TCGACGCGGGAGTTCTACCTGGAGGGCGGCGCGATGGTCTTGGCCGACGGCGGGGTGGTGTGCATTGACGAGTTTGACAA
GATGCGGGACGAGGACCGGGTGGCGATCCACGAGGCGATGGAGCAGCAGACGATCTCGATTGCCAAGGCGGGTATCACGA
CGATCCTCAACGCGCGGACATCAGTGCTGGCGGCAGCGAACCCGATCTTTGGGCGGTACGACGACATGAAGACGCCAGGC
GAGAACATTGACTTCCAGACGACGATCCTGTCGCGGTTTGACATGATCTTCATCGTCAAGGACGAGCACGAGCGCGGCAA
GGACGAGCGGATGGCGAGGCACGTCATGGGCATCCACATGGGTGGACGCGGCGTGGAGGATCAGGTAGAGTCGGAGATTC
CGGTGGAGAAGCTCAAGCGGTACATCAACTACTGCAAGACGTGAGTATCCCCTTTGATGTTTCTGATTGCCAATGATTTC
GAACCGGTGGCTAACAGCACAGACGTTGTGCCCCCCGGCTGAGCGCGGAGGCAGCAGAGAAGTTGTCGTCGCATTTTGTG
TCGATCCGACGGCAGGTGCACGCGGCCGAGCTGGAGGCCAACGCGCGGTCGAGCATTCCGATCACGGTGCGGCAGCTAGA
GGCTATTGTGCGGATCACAGAGGCGCTGGCCAAGCTGACGCTGTCACCGGTGGCGATGGAGCAGCACGTGGACGAAGCTA
TCCGGCTGTTCCTCTGCTCGACCATGGATGCGGTCAACCAGGGTAGCCAGATGGGCGCAGGCGCGGGAGCGGGTGCCGGT
GGCGGCGCGGCGCGCGAGCTGTACCAGGAGGCGGCGCGCGTGGAGTCGGAGCTGAAGCGACGGCTGCCGATCGGTTGGAG
CACGAGCCTGGCGACGCTTCGGCGAGAAATGGTGGAGGTGCGAGGATTCAGCGAGCAGGCGCTGAATAGGGCGCTGATGT
TGCTGCAGCGACGAGACACCATCATCTTCCGGAACGGAGGTGCCCAGGTGTATCGGAATGGAGCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62