GenePrediction:GLEAN_6303 Details

Name: GLEAN_6303
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:923910..922877 (- strand)
Length: 1034
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:923910..923639 (- strand)
Length: 272
Type: CDS
Source: GLEAN
Position: GCSC_144:923525..922877 (- strand)
Length: 649
>GLEAN_6303 class=GenePrediction position=GCSC_144:923910..922877 (- strand)
ATGGCGTCCAGATCCATGCACACGCCGCCGCGACAGACGCTTGCCGGCCTGGCTGCTGCTAGGGGCCGAGCGTCGTCGGC
AAGGAGGGCGACCGCCGCAGACAGCCCGGGCAACTGGCGGCATCCTCGCATGGACGAGATCACGCGGCGGCGCTCGGCCA
ACGTGTTTACCGAGTCCAACCTTAAGACGGCCATCTACAACGGCCTGGCCCTGGGTGTCGTGTACGTTGCCCGGACGGCC
AACGGGACTGTCTACCAGCAGATCTGTCGATTGTAGGTTTTACTTTAGGGCGTTCTTCCTCTTGTTTTCTCCTCTTCCGT
TCTTCTCTCTTCCTTTCTTCTCCTTTCGTCCTCTTCTTCTCCTACTCACCGACCAGTGCACACAGTTTGGTTCCTGTTCG
ATACGCGCCCACGCTCTGGCTCCTCGTCCAGCTCGCCCTCGTCCTCAACATCGCCCGGGCCATCATGCCTCTTTTCCGCC
AGCCCGACACCATGGCCGATATCCCGCTGACGCCCGGCCAGCGCAAGCTGCTCGGCCTGGTGCCTGTCCGCATGTCGGCC
TCGGTCACCCCCGGAGGCGTTGCTGCCTTCACCACGCCGCCGCGCTACGCCCGCACGCCGTCCATGTCGAGCTCGCCAGC
CGCCGCCGCCAGCGGCCTCACCGCCGCCAGCAATATGGCCACCGGGTCGCGCAGCAGCTACGCCAGCTACACGAGCTCGC
CTATCTCCAGCAGCCCGCTCTTCAACAAGACCCGCGCCGTCTCAGGCACCAGCTCGTCCTTCTCGACTGCTGCCAGCCCC
TTTCCCAAGGGACGGAGGTCGTCGTTTGGGTCGTTTGGGTCGCCTGGCGCGGTCTCGTCTGGAGCTGGCCCTGCGAGCGC
CCCGTCGCCGTCGTTGTTCTCCGAATCAACCCTCTCTGTCTTCCCGGGAACGCCCAGCCCCAGCTCGGGAAAGCGCCTCA
GCATGGGACTCAACAACAAGTGGCTATACGAGAAGGGCCGGCGAGGCTCCGGCAGTGCGGCCCGGATCTACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62