GenePrediction:GLEAN_6304 Details

Name: GLEAN_6304
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:922423..919342 (- strand)
Length: 3082
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:922423..922328 (- strand)
Length: 96
Type: CDS
Source: GLEAN
Position: GCSC_144:922227..921496 (- strand)
Length: 732
Type: CDS
Source: GLEAN
Position: GCSC_144:921435..919342 (- strand)
Length: 2094
>GLEAN_6304 class=GenePrediction position=GCSC_144:922423..919342 (- strand)
ATGGGTGCTAGTGACTCGAAGCTCGTCTTCAAAAAGGGCATCTTCCGGCTGTCGGAAGAGCGAAACATCCCTGCCGACGA
CCCATACTGGACATCGGTATGCGAACAAGAGGGGAGGGGGGAGAAGAGTGGGGGGAGCTTGGAGGAGATGAGGGTCTGCA
CGAAAGTGTGTCGAAAGCTGACTCTTGTTGGTGTAGTTCTGGGACCTGCCCGAATCGCCAGAGGACATCTTCAGCCTCTT
CTCACCGGCCGACATTCGACGGACGCGCGACACGGCCCTGGAGAACTTGGAGACGCTACTGCTGGCGGTGACATCACGGC
TCTTCAGTCTGCGCCACCACGCCGCCTTTCCCGACCCAGATGTAGCCCCAGAGCGGGATGCGCTCAACTGCATCCGCGTG
CTGACCCGCGTGCTGCCGTACATCTACGAGCGCGCGTCGCTGAGCGGCTGGGAGGAGCGCTTCTTCTGGACGGCCCGACG
ACGACGGACGCACCGGCCGTCAGGCAGTAGCAGTGTGGCTGCCGACCGTGAGGTGCTCTTTGACCAGACCAACGTCGACG
ATGGCCCGAAAAACGAGGCCGCGTTTGAAGACGTCAAGCCGCTGGCCGAAGAGCTCATCGACACGCTGACAGACCTGCTC
TTCTTCGCCGACTTCACCGTGACCCGGCCGCCGGCCGCCGTCGACCCCGGCAAGGTCACGTATGCCATCTGGCAGAGTGG
CGTCGGCTGCAACGCGGCCATGCCGACGACGCGCGAGTTTGAGAGCAACCGCTGCGAGATCTTGCGCCTGCTATTGACTC
TCGCCAGCCCCAGCATGTACTCACCTCCCGGTGCTCTGCCGCGCCAAGGCATTCGCGCCCTCACCTACATCTGTACCTGT
CCGGACAAGCAGGTCGTGCTGTCGGTCCTCTGTTCGCTGCTGAACACGGTGAGTCTGTGTCTCATCGTTTGCTGTCGGCC
ACTGCTCGTTCGCTTCTGACGCTCGCAGACGCTCAAGTACAATCCCGCCAGCTGGCGCATGCCCTACAACAGCCTCGTGC
TCAAGGACCAGAAACAAATCCTCGTCACCTACACGCTGCAGCTCCTGCTCGTGCTCGTCCTCTACCCTGTGCCCGAGCAC
GACGGCTTCGCGCCCAAGAACTACTATCGCCACTTCCTCGGGCGCCTGCACCGTCCCGCCGACTTTCAGTTCCTCGTCGA
TGGCATGACCCGTATCCTCCATCAGCCGCTCCAGGCCAACGCTTCCTACATTCCCGGCACTCAGTCGTCCGTCCGGTTCG
CGCCTGAGATCATCATGCTCTTTTGGGAAATCACCCAGTGCAACCGGCGCTTCCGCTCCTTCCTCATCGACACCGAGAGG
GTCCACGACTTTGTCATCCTCATCCTCTTCTACGCCCTCGAGTCCAGGAACGACGGCAGCAAGCAGGGCATCGTCCGCAT
GTGCGTCTTTCTGCTGCAGACGCTGAGCGTCGAGAAGAACTTTGGCATCAATCTGAACAGGCCCTTTGCCGCCCAGGAAA
CCCTGCCACCGGCCATCCGCATCCAGGGCTTCCGCGGCACCTACGCCGACTTTCTCGTCCAGTCCATCTACAGCCTCATC
ACCAGCAGCCAGAGCAGGCTGACGGCCATCTATCCCGCCCTCCTGGCCATCATCAACAACGTCGCCCCACATATCGCCGG
TCTCAGCCTGCGGACATGTTCGCGCTTGATGCAGCTCTTCGGCTCCATGTCGTCTCCTTCCTTCCTTCTCGCCAACGATA
CGAACCACGACCTCCTCTCATCCCTCCTCGAGGCGTTCAACGCCACCATCGAGCACCAATACAAGAGTGAGTACCGCATT
CCGTCGTGTCCCGTTGCAACAGGTCAGCCTTTTAACGAACTCGCAGAGAACCCACAGCTAGTATACACAATCGTCAAAAA
CAAGAGGCGGTTCGAGGCGCTGCGCAACTTCACGCTGGAAAGCGGCCGTGAAGAGATTGAGCGCCGCATGCAGCTCCGCA
AGGACTCGGGCGTATCGGCCGAAGACCCGATGGAGATGGCTTCGATCCGGAGTTCAGTGGAGAGCCTGCGCAGCCCCAGC
ACGCCGCAACATCACGTCCAGCCGCCGGTGCTGAGCAATGTGCCAGAGAACGAGACGTTTGCGATTGGAGGCGATGAGAG
CGACAGCGACGCAGAAGCCGACAGCGATTCCGAGACGCGCACTGCTGGTGCCGGTGCCGCCAACGACGACGACGACAATG
AGGAGGATGAAGACGAAGACGAAGACGAAGACGAAGAGAATGAGCCACGACCAACGCCATCGCAGTCCAGCCTCAGCGAG
AACCCGAGCGGTGCATCGTCGGTGATCTCAGTCGAGGACGCGGTGCCGATACAGCTACGGGGCATGTCGGAGAAGGCCCG
CGGCAAGATGCCAGTCGGCACGCCCAGCTTCTCGCGGCAGAACAGCGCGCTGAGCATCGGGAGCACGTCCACGGGCGTCA
TCGCGAGTGGAGGCCACAGAGGCCACCATCGCTACAGCCTCAGCCACGGCCACGGCCACGGCCACGGCCATAGCCAGAGC
GTTGGCAGCATTGGTAGCGTGGGCTGTGGTGGGGGATACTTTGAGCCGACAGCGCAGTGGATCGACAGCTGGCTGCCAGA
GCTGCCACTGCACACAACGCTGACGCTGATCCAACAGCTGACGGCGCTGCTGCCGCGCGAGGAGCTGGCGGTCGACGTGC
CGGCGACCGAGACGCTGCGGCGGATTCAGGACGTGCAGCTAGTGGGCATCGATCCATCACCGATTCGGGTGCACTCGTTT
GAATGGTCGCCGCTGTCGCTGGGCTGGTACGAGTCGTTGATCTGGAGCTTTATCTTTAGTAGCGAGATGCAGGTGGCCCG
GGGCACCGTCGGCGTCTGGAACGGCACCGCCATCAAGCTTTTTCGCGTCCAGGAGACCGCGCCGCAAGGCCCGTCACTGA
CGTCGCCGCGCGGTGCCGTCGATGCCGTGGGTAGCAACATTGTGTCGCGCATCGGGGCTATCAACCTGCGCGGGAGCGGA
GGCGGCATCACGGGAACGGCCGGCGGGAACAGCGCGTCCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62