GenePrediction:GLEAN_6305 Details

Name: GLEAN_6305
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:919010..918114 (- strand)
Length: 897
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:919010..918868 (- strand)
Length: 143
Type: CDS
Source: GLEAN
Position: GCSC_144:918792..918508 (- strand)
Length: 285
Type: CDS
Source: GLEAN
Position: GCSC_144:918423..918114 (- strand)
Length: 310
>GLEAN_6305 class=GenePrediction position=GCSC_144:919010..918114 (- strand)
ATGTACTCTTCATTTGTCCGCCTGCAGAATGTCTTTGGCTTCTTCACCACCATCGTGACGATCCTCGGCAGCCTCATCGC
AGCTACTGACCTGCTGCATGCACGCACGCCCAGCGCCACCGTGCGGCCGGCGGGTCTGCAGGTGTATGTGTAGGGAGACA
AAGAAGGGTGACTGGCAGTGTGCTTGTGGCTAATGTTCTTTTTGTCCTTGTTTCGCAGAGTTCGTGGCCGCCCACACTAC
TACAGCAAGAAGAACGAAGAGTACGCCGTGGTACGCTTCCACCTGGACGCGGACCTGTCGTCGCTCTTCACGTGGAACAC
CAAAGAGGTGTTTGTCTACGTGACGGCCGAGTGGGAGGGCGCTAACAGCAGCGACACCAACACGGCCGTCATCTGGGACA
GCATCATCACGAGCCCCAGCTCCGACTACCTCGCCAACATCGGGCCCGTGGCCATGCGGAAGCTGCGCAAGAGCGCCGCG
GGAAAATCGATCGACCCGAGCCGGTGCGTCTCCCCGGCTCTCTCTCTCTCTCTCGTCTTCTTCTGTCTCCTAGCCTCTCC
CGTCTCACACTTGCTAACATCCCCCAGCGGCATCATCCACCTCAAGAACCAGAAGCCCAAGTACCAGATCACCCACCCGA
GCGGCAAGATCGCCGAGACGGAAAAGGTTCGCTTGCGCCTGCACTACAACGTCCAGCCGTGGGTCGGCATGCTGTCGTGG
AACCAGGAGGCATCAGACGCAGACAGCAGCAGCAGCAGTGACGGTATCTGGGCATGGGTACCCCGTCATGGCACGGTCCA
GTCGCCGCTGTGGGCATCGATAGATGGCGGCAAGAGCGAGTCGTTTGCGCTGCCCGCAATTGTGGGCAAGAAGAAGACTA
CCACAAACAGCTCTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62