GenePrediction:GLEAN_6307 Details

Name: GLEAN_6307
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:912895..911296 (- strand)
Length: 1600
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:912895..912862 (- strand)
Length: 34
Type: CDS
Source: GLEAN
Position: GCSC_144:912807..912754 (- strand)
Length: 54
Type: CDS
Source: GLEAN
Position: GCSC_144:912700..912649 (- strand)
Length: 52
Type: CDS
Source: GLEAN
Position: GCSC_144:912599..911559 (- strand)
Length: 1041
Type: CDS
Source: GLEAN
Position: GCSC_144:911476..911296 (- strand)
Length: 181
>GLEAN_6307 class=GenePrediction position=GCSC_144:912895..911296 (- strand)
ATGGGGCCACCCCAGGTTGTCGACGACGTGGACGGTAAGCCGAGACGGGAGCGACAGACGAAGACAACTGTGGCTGACAG
GACGGCAGTGGACATGGAGCACGACGAGGACACGGAACAGGAGCAGCGGCTGATCAACGAGGGTGAGTGTGACGCGATGG
TAGCTGTCGTCTGAGCACGAGCTGAATTGGAACAGAATACAAGACGTGGAAGAAGAACAGTCCGTTTCTCTACGACATGA
TCCTGAGGTGGGTAGTTTGTCTAGCTGTCTGTTTTCTGGTCTGTCTAACAAAGCAGCAACGCGCTCCCGTGGCCGACACT
CACGACGCAGTGGTTTCCCGACGTCAAGGAGCTGCCCGACAAGAAGTGCCGGGTGTACCGGCTGCTGTTGGGCACGCACA
CGTCCGAGGGCCAGCCGAACTACGTGCAGATTGCCGAGGTGTCGATCCCAATGGCAGGCGAGCCGAGCGCACACGACTAC
GACGACGAGCGCGGTGATGTGGGCGGCTACACGGGCAAGGCGGGTGCAGCCGGCAACGGAAACACGGCGACGCCGGCCAT
CAGCTTCAGCATCGTGCAGAAGATCGACCACCCGCAGGAGGTCAACAAGGCGCGCTACCAGCCGCAGAACCCGGACATCA
TCGCGACCTTTGCCGTCGATGGCCGCGTCCTCATCTTTGACCGCACCAAGCACAGCCTGACGCCGGCTGGCGTCGTGAGC
CCGCAGTTTGAGCTGGCCGGCCACCGCCAGGAGGGCTTCGGCCTCGCCTGGAACCCCCACGAGCCCGGCTGTCTGGCCTC
GGGCAGCGAGGACGCCACCGTCTGTCTCTGGGACCTCCATGCGGCCGCTGCTGCTGCTGCTTCTGCTGGCGGCAGCCGCG
TCGTCAAGCAGCCGGCTCGTCGTCTTACCCACCACAGCCAGATCGTCAACGACGTCCAGTATCATCCTGTCTCGCGCAGC
TTCCTCGGCAGCGTCTCCGACGACCTCACGCTCCAGATCGTCGATGTTCGCCAGCCGGCCAATGACCGTGCCGCTCTCGT
CGCCCGTGACGGCCACAGCGATGCCGTCAATGCCCTCGCCTTCAACCCGGCCAGCGAGTACATCGTTGCGACCGCGTCGG
CCGACAAGACCATCGGCCTCTGGGACCTCCGCAACGTCCGCGAAAAGGTCCACACCCTCGAGGGCCACAGCGACGCCGTC
ACCTCCCTGGCCTGGCATCCTCACGAACCGGCCATCCTCGGCAGCGGCAGCTATGACCGCCGCATCATCTTCTGGGACCT
CAGCCGCGTTGGCGAGGAGCAGCTGCCCGACGACCAGGAGGACGGACCTCCGGAACTGTACGTTTGTGGTAGCGTTGTGC
TGTACTATTTTTTTCGTTTTTTCGTTTTTTGCCGTCTCCGTCACTAATTCCTATCACAGCCTCTTCATGCATGGCGGCCA
CACAAACCATCTGGCCGACTTCAGCTGGAACCCGAACCCCGCCGACTCCTGGCTCGTGTGCAGCGCCGCCGAGGACAACC
TGCTGCAGATCTGGAAGGTGGCCGATTCCATCGTCGGCCGCGACGACGCCGACCTGCCCGTGGACGAGATGGACCGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62