GenePrediction:GLEAN_6309 Details

Name: GLEAN_6309
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:901316..900877 (- strand)
Length: 440
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:901316..901271 (- strand)
Length: 46
Type: CDS
Source: GLEAN
Position: GCSC_144:901209..901134 (- strand)
Length: 76
Type: CDS
Source: GLEAN
Position: GCSC_144:901039..900877 (- strand)
Length: 163
>GLEAN_6309 class=GenePrediction position=GCSC_144:901316..900877 (- strand)
ATGGGTGCCGTATCTGCTGTGTTTCTTGTTCTCATTACAATCATCTGTGCGTAAACACAATGTCCACCCGTCTTCCACCG
GTTGTATTGCCGGCTAACTGGAATTAGTCCCCCCCCTGGGCGCCTTCGCCGTGGCTGGTTGCGGCGCCGATCTCCTAATC
AATGTCTGCTTGACAATTCTGGGGTAAGTCGGATGTGAAGCTGGTCTACGAACAGCTCCTCACCATTCATGCTTTGTGTC
GCCACCTCCTTTCACGGATAAGCTGACCTAGCCATAGTGTGATTCCCGGCCATCTCCACGCTTTCTATCTGGAATACGTC
TACTATGATCGTCGCGAGCAGGCCCGCGAGGGTCATTTCACTGCCGGCCGGGCCCCTGGCATATACAGCGATCGCGTGCA
GCAGGGCGGCGGCTACGGCACGATTGTGCACCAGACGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62