GenePrediction:GLEAN_630 Details

Name: GLEAN_630
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1098808..1099518 (+ strand)
Length: 711
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1098808..1098882 (+ strand)
Length: 75
Type: CDS
Source: GLEAN
Position: GCSC_97:1098990..1099436 (+ strand)
Length: 447
Type: CDS
Source: GLEAN
Position: GCSC_97:1099498..1099518 (+ strand)
Length: 21
>GLEAN_630 class=GenePrediction position=GCSC_97:1098808..1099518 (+ strand)
ATGGGTCAGGGCATGTCATGGCTGTCGGGCCTCTTGTGGGCAAAGAAGGAGATCAGGATTCTGATTCTCGGACTGGTACT
ATTTTCCCGCGTTCGCGTCTTCGATCAAAGCGCTCTTGGTCGAAAGAACGAGTCGACATGTGAAATTCGGGCTAACAACC
GTCTTGCTTCGCCTAACAACAGGACAACGCAGGAAAGACGACGCTGCTGTACAGACTCAAGATAGGAGAGGTTGTCACGA
CGATCCCGACGATTGGCTTCAACGTAGAGTCAGTGACCTACAAAAACCTCAACTTCAACGTGTGGGATCTTGGCGGGCAG
ACATCGATTCGGCCATACTGGCGGTGCTACTATGCGAACACGGCAGCGGTCATCTTTGTGGTAGACTCGACAGATATTGA
GCGGTTACAAACAGCGGCAGAGGAGTTGGCGTCTATGTTGAATGAAGAGGAGCTCAAAGATGCGGCACTGCTGGTGTTCG
CCAATAAGCAGGATCAGCCGGGGGCAAAAGGGGCGGCAGACATCTCGCAAGCGTTGCGGTTGGGCGAGTTGCGAGACCGC
AACTGGAGCATCGTGGCATGTTCGGCAGTAGATGGCAGCGGCGTGAGCGAAGGCATGGACTGGCTTGTGGTGAGTCGATG
AAAAAGGGGGAAGGGGTAAAAACAAAAGCATGCTGGCTGACAAAGAGTAGCAAACGGTATCTCAGGAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62