GenePrediction:GLEAN_6311 Details

Name: GLEAN_6311
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:888335..885873 (- strand)
Length: 2463
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:888335..888260 (- strand)
Length: 76
Type: CDS
Source: GLEAN
Position: GCSC_144:888154..888057 (- strand)
Length: 98
Type: CDS
Source: GLEAN
Position: GCSC_144:887934..887659 (- strand)
Length: 276
Type: CDS
Source: GLEAN
Position: GCSC_144:887587..886032 (- strand)
Length: 1556
Type: CDS
Source: GLEAN
Position: GCSC_144:885975..885873 (- strand)
Length: 103
>GLEAN_6311 class=GenePrediction position=GCSC_144:888335..885873 (- strand)
ATGGCGGATGCGCGCGCGCAGCGGGAGGTGAAGAATCACTTCCTCTTCGAGGTTGCCACGGAAGTGGCGCACCGTGGTAC
GTCTGTCTCAATCGTGGCATCGTCCTGAATAGCATTTCGTCTCTCCTGTTAAAACTGCACGGGCTGGTTTTCTAAACTGC
TTTTTTGTTGCGCGGTTTTAGTGGGAGGCATCTACTCTGTCATCAAGTCCAAAGCTCCGGTGACGACAGCCGAATATGGA
GACCGCTACACACTTATCGGGCCTCTCCACCGCGAGTCGGTATGTTGAAACAGTGCTGCTCGGTAGTCTTGCCCTGTGGT
TTTTTTGCGGCCATGACTTGGCGAGGCATTGGGCGCATGTACCGGTTATGTTCGTTGGGCTGACTCTAGATTGGGCATTA
GGCAGCTGTTGAGGTTGAGGAGCTTGAGCCGACAAACCCCGAGCTTGCTGCCACCATTACGTCCATGAGGGATCGTGGTA
TTGGCATGCTCTATGGCCGCTGGCTGATCGAGGGGGCTCCGAGAGTTCTGCTCATTGATACCAAGTCTGCCTATGGCTTT
CTCGACGAGTGGAAGGCGGATCTCTGGAACGTCGCATCTATTCCCGCTCCCCCAAGCGACGACGAGACGAACGAAGCTAT
CGTTTTCGGCTACCTTGTTGCTTGGTTTCTCGGAGAGGTGAGCAAATTCTGCAAGACAGTGGGGTTATTTCTGGCTGCAT
TTCCATGCTGACGGTCGCCACCCCTCAGTTCGTATGCCATGAAAAGAAGAAGGCCGTTATTGCCCATTTCCACGAATGGT
TGGCCGGCGTTGCCTTGCCATTGTGCAAGAAGCGTCAAATAGACGTCACGACCATCTTCACCACTCATGCCACGCTCCTG
GGTCGTTACCTCTGCGCTGGTTCGGTTGATTTCTACAACAACCTCCAGTACTTCGACGTGGATGCGGAGGCAGGGAAGCG
CGGCATTTACCACAGGTACTGCATCGAGCGTGCCGCCGCCCACTCTTCTGATGTGTTCACAACGGTCTCCCATATCACGG
CTTATGAGAGCGAGCACCTGCTGAAGCGCAAACCCGATGGCGTGCTACCCAACGGCCTCAACGTGACCAAGTTCTCGGCC
ATGCATGAGTTCCAGAACCTGCACCAGCATAACAAGGAGAAGATCCACGACTTTGTGCGCGGCCACTTCTACGGTCACTA
CGATATCGAGCCGGAGAACACGCTCTATTTCTTCACAGCCGGCCGCTATGAGTACCGCAATAAGGGCGTAGACATGTTTA
TTGAGTCTCTGGCTCGTCTGAACCACCGCCTGAAGGTCTCCGGCAGCAAGATGACTGTTGTCGCTTTCATCATCATGCCA
GCCCAGACGCACTCCCTCACGGTCGAGGCGCTCAAGGGACAGGCTGTGGTGAAGTCGCTGCGCGATACCGTCGACATCAT
TGAGAAGAGCATTGGCCGACGGATCTTTGAACGCTCGCTCAAGTGGCACGAAGGCGATTCCATGCCCGACGAAAAGGAGC
TTATCACTAGCCAGGACCGCGTGCTTCTTCGTCGCCGGCTGTTTGCCATGAAGCGTCACGGCCTGCCCCCCATCGTGACG
CACAACATGGTCAATGACCAGGAGGATCCGATTCTCAACCAGATCCGGCGGGTGCAGCTGTTCAACCACCCCACCGACCG
CGTCAAGATTGTGTTCCACCCCGAGTTCCTGAGCTCGGCAAACCCGGTGCTGCCTATGGACTATGACGACTTTGTGCGTG
GCACTCACTTGGGCGTATTTTCTTCCTACTATGAGCCGTGGGGCTACACGCCGGCCGAGTGTACAGTGATGGGTGTTCCT
AGCATCACGACCAACCTCTCCGGCTTCGGTTGTTACATGGAGGAGCTGATTGAGAACTCGAGCGACTACGGCATCTACAT
TGTCGATCGGCGGACAAAGGGCGTCGATGAGTCGATCAACCAGCTAGCGTCTGTCATGTTTGAGTTCTGCCAGAAGAGCA
AGCGACAGCGCATTAACCAGCGAAACCGAACGGAGCGGCTGAGCGACCTGCTGGACTGGAAGCGCATGGGGCTGGAGTAT
GTCAAGGCACGCCAACTGGCGCTGCGCCGCGCGTACCCTGCGTCTTTCACCGGAGAGGATGATGACGACTTCATTCCGGG
CGTGGAGCAGAAGATTTCCCGGCCCTTCTCGGTGCCTGGCTCTCCTCGTGACCGCACCGGCATGATGACCCCAGGCGACT
TTGCCAGCCTGCAAGAGGGTCGGGAAGGACTGAGCACGGAAGATTACGTTGCGTGGAAGCTACCGTGAGTTGCCCCATAC
ACCTAACAAGCTGAGCGTCTTGACTGACAAACGATACCAGAGAGGAGGAAGATCCGGATGAGTACCCGTTCCCGTTGACG
CTGAAGTCGAAGACTGTAGGCGCGAGCAGCCCGCTCGATGGAGTGCAGCTGAACGGTAGATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62