GenePrediction:GLEAN_6312 Details

Name: GLEAN_6312
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:884438..882062 (- strand)
Length: 2377
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:884438..883966 (- strand)
Length: 473
Type: CDS
Source: GLEAN
Position: GCSC_144:883883..882062 (- strand)
Length: 1822
>GLEAN_6312 class=GenePrediction position=GCSC_144:884438..882062 (- strand)
ATGAAGTTTTTCAGGCGAGACAAACAACGCAAGGCCAATGGCTCTAGCGACCAGCAGTACCTCACCTCGAACAGCCCCAC
CGTGCCACAGTTCCCCAGCTCCCAGTCCGGCGACGCATCACATCCTAATGGTGGTACCGGCAGCCGTAGCCGTGGCTTTG
GAGGTCTCAAAGGCTTTCGTGGCCGCCACGGCAGTGCCAGCGCCAACAGCATCGCGCATCACCGGCACAAATCCTCTTCG
TCTCCGGTCCCAATACCGCCACCACCAGGGGCGCCAGCTCGTGCGCTGCTCAAGCTGCCGGATCCCGTGCTTGAGCGCAT
CTTCTCCCTCGTCTGTCCTCACAGCCAGGACCGGTCCTATGACAAGTGCGAGGATTCAGGTTCTGATAGTGCGTGCATGC
TCTGTGACATGCGCGACCTGGCCCACTGTGTTCAGGTGTGCCGGCGATGGCGTGTCGCCGCCGAACGCGTTCTGTATGCT
ATCCCCCCTGCTCTCCTTGATGCGCCGTCCATACGGCCTTGCGCACTGCCACTAACAGTTGCCTTTCTTTGCTAGCTACA
CCAGCGTCCGCATCGACGCGGTTCACTACTGCGAACGCGAAGATGACCTTGCGGAACGTCGAAAACGCCGGTCCTTTTTC
GACCGCAACGCCGAACCCGATGAAGACACTGCCGACATCCGGCTCAAGCTCCTAAGTCGCACCCTTCGCGAACATCCAGA
CGGCCGGCTGGGTGCCACAGTCCACTTCCTCAAGATCCCCTACATGCTACGCGAGTCCAAACACGCCGACATTGCCCGCA
CGGTCTCGTTGCTGCCAAATCTGCGCTACGTCGACCTGCCTGAAGGCCTCTTCATGGACGACCCCACCTACGTGACTCTC
AAGCACGAGATTCAGGCCAGGTGTCCCGAGCTTCGCAAGATGACCTACATGGGCGGCTCTGAGCGCAGTCTCGCGGCTCT
TGGCTCCGGCACCATCTGGCCCAGCCTTGAGGTGCTGGAGCTGGTGCGAATCGGCATGGACCCGGCTACACTCCGACACG
TCCTCAGTGCCCTACCGAACCTACGCGCTCTCAAGGTGACGGAGACGACGGCTGGCCCGCACACTTTCTCCGACGACGTC
CTTGCATCATCGGCATCGGAATACTCCGCGGACGCGTCGGACTCGTCCGGCTTCTATCAAGAACAGAACGGATATTCCCC
CGAAGTCCCGCCTCTGGAAGAGCTTGTCCTGACGGATACCCTTGGCCTCACAGCTGCTGGCTTGCAAGGGTATCTAAGTC
GGCCGGATGCGCGCCAGGCGTTAAAGGTGCTCACTGTCAGCGGCACCGGAATCAAGCCATGGTCTCTGCAGGTGTTGCTC
ACCCAGATGCCATCGCTGCGCCACCTCACCATTGTCGAAAGGGTGACCGCAACCCTACCCGTGGCTGCGGGCACCAAGGA
GATCCGTCCTCTGGTATCACAGTCACTGCGCACGCTGAATTACGAGATCAGAGCAGCCGACGGCGTCAGCCCGTACGCCG
GTATCACCCGCTCCTACTACAACTATCTGTCGGGCTCCATCCTATCGGGTGGGTTGCCGAACCTGCGGGCTGTGTATGTG
TGTGACGCACAGTTCCCAGATCTACTGCTGCTTGGGAGCGCCTTGCCTCCACCACCGGGTCTCTTCGGAGCCCCCAGCGC
GCAGAACCGACCGTCCTCGGCCGGCTCCATCGGATCTGCGCCGCGCCTCTCGATGATGTCGGGTCGCAGCAGCAACAGCA
ATCTCGGGCTTCTGTACGCGTCGGCCAACATGCAGAGCCCCCCTCATTCGCCGGGCCTGCGCCAGCCGCCCGTCCTACAG
CCGCAGCCACAACGACAGTCTCTCAACCCGTTTTTGGACCCACAATCACCGTTTAAAGCGGCAGCCAGGCCTTCTTCGCC
GAACCCCGCGAAGCCATGGGCGACCGGCCAGAACCCACGGTTCAGCAGCAACAATCCGTTCGCGGCGATGATCTCACCGC
AGCAGGTGCGGACGCTCGAGGTGTTTACTAAGGGTGATGACGACCTCGACTGGAGCTCGTTTGTGGTCGACGGCGGAGAC
GCAGGGGGCAGCGGCCTGGGCAATTCAGAGCGACCGACCAGCAGTTACGGACTTGGGGCGGATCTGGGCGCCGGAGCAGG
AGCACGCAAGAGCGTTCTTCTGCATACAGGCGCGGGGGACTTTCTGGCAGTGCCGGACGGAGCATTTGCTGGCGGTGGCG
TTGGTGGCAACGGAATGCCCGACAATCGACGGGACAGCCACATGGATCGCAACGGACAAGGGGGTGCTGACCTGTGGCCA
AGGCCAAGGAGCAGTGCGGGTGACAAGAAGAACGAGAAGCGGGACCTGTGGCGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62