GenePrediction:GLEAN_6313 Details

Name: GLEAN_6313
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:878047..876492 (- strand)
Length: 1556
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:878047..876793 (- strand)
Length: 1255
Type: CDS
Source: GLEAN
Position: GCSC_144:876616..876492 (- strand)
Length: 125
>GLEAN_6313 class=GenePrediction position=GCSC_144:878047..876492 (- strand)
ATGTCTCTTGACGACGACATTGGCGTCTACCTTGCCAGAATGGGTCCCGACACGGTGAAAGCTCCAACCGGCGAGACGAC
AGTTGTGCACCACCAACCGCAACAACAACAACAACAACAACAGCAGCCAGAGAACAATTCGACTCTGCCTGCAGCATCAA
ATATGCAGCACGATATGAGCTGCCTCGGCATGGCACCACCGCTCCCTGAGCGCAATGCGCTCCGCCGCTCGCGATTCCTA
GACGCCCTCGTCATGCAGGCCGCTGTGCCGTCAGAAACTGCCGAGGCTGCGTCTGTGGCCATGGCTCCGAACACCAGCAG
GCCATCACTGCCTACGCCACACGACGTCTATCTCTCATCGGAAGAGGATGCTTCGTCTGCCGGCGATGTCTCCGAGGACG
AAGATGTGGACGAGTACAGTGGCACAATGGAGGACGATGGCAGCACCTGCTACGGCTTCCGTGACCAAGGGGACGACGAC
ATTGCCCGGCCGGACCGGCTGTCCTCCCCCGACAGCGTTCCTCGCCACGGCCCTGTTCCAGAGCCGTCTGCTCTCCCCCC
TTCCACCGAAGCCACCGATCCTGTCAACGCTGCCACCACTTCCACCACTACCATAGCTACGGCTGTGGTTCAGCCTCGCC
GCCTCCAGAACCGCGACACGGCTCGCGTCGTGTCCGTCATCTTTTCCGGCCGGCCCTCTCTGGTCGATCTTGCTCTGCTG
CGGGAGGCTCGCCGCCGCAGTTGCATCGACACAACCACGCAGTCCGTGCTGTCGTCGTCTGCCTCGTCTAACTCTGCCAC
ATCCTCTTCTTGCATCAATTCCACCTCGGCCTCCGAGGTCACACGCCCATCGACGGCGAGCGACTCGCTGACGTCCGACC
ACAACGCTAGCAACTGCGCCCTGTCCTCTTACCGCGACCGCAGATGTGCTATGGAGAACGTTAGGCCCACTGATATCAAC
CTCGGAGCTACACTCGAAGCCACAAAGCGAGCATCACAGGCTTTCCTTCTGACGGACCCTTTCGCCAACAACCACCACTC
CCATTCGCACAAGAACTCTGCAAATGGTGCACAATCCGCACCTCAGAAGCGCTCTTTTTCATCCTCCCCCCCTACTAATA
CAGATTCGCCATCGGCTTCTCATTCAACGCCACCTTCTCATTCATCATCGTCTACTCCCTCTACGCCTAGCGCCATTCTG
CGTGGTGTTACCCGTTCCCTGACCTTGAGTCGCCGCCGCAGTCGGCCAATGCTTCGTGTCGAGTCCTTGACACAACAATC
TCTCAAATCGCCAGCCTTGGCTGTAACACCACCATTGCCTTCGGCGTTGTCGGCTTCGGCGCTGGCACCCTCTCCAGTCA
CATACAATGATATAGTACAATCGGCGCGGCGCAAGTCGACTGCCCCTTTGCTACCGTCTCGGCCTTGTCAGTGCCGGAGG
ACATGCCGGTTTCGCCTATGCCGCCAATGACGCCGGGAATGGCGAAGCGTGGCAACACTGGTGGCTTTTTGGGCAACCTG
GCTGGAAGGCGGCGGAGTATGAAGGTCACTCGATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62