GenePrediction:GLEAN_6314 Details

Name: GLEAN_6314
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:871263..870476 (- strand)
Length: 788
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:871263..871040 (- strand)
Length: 224
Type: CDS
Source: GLEAN
Position: GCSC_144:870907..870862 (- strand)
Length: 46
Type: CDS
Source: GLEAN
Position: GCSC_144:870789..870672 (- strand)
Length: 118
Type: CDS
Source: GLEAN
Position: GCSC_144:870597..870476 (- strand)
Length: 122
>GLEAN_6314 class=GenePrediction position=GCSC_144:871263..870476 (- strand)
ATGTCTGCCTCGATCCTCCGTGTGGCCGCCCGCGGCCCTGCCACGACGTTTTTCCGCGCAAACCCCATCCGCCCGACAGC
ATCGGCCGGCGCGGCCGTGGCCTCGGTTCTTCACGCCCGCACCACGGCTGTCGCGGCCGTCATGGTGCCCAGCGTCAGCT
TCAGCGCAGCTGCACGTCTGCGGTCTGAGCACCACGAGGAGTCCTTTGAGGAGTTTACCGCCAGGTAAGATCCCTTCTGT
CTCCATAGGAAGGCCCCTCCGGGCCTCCGGGAGAATCCGGTACCGCTCGGACAGGGGATGAGGGTGAGAGAAGAGACTGG
ACATTGTGGGCTGACTGCTGGGCCTGCCCCATACAGATTCGAGAAGGAGTTCGACACCGTCCAGGACGTCTTTGAGCTGC
AGGTAAGCCCACACCTTTCCACCCCCAGTTTTCCCCCCCCGGTACCCCGGCCCCAATGCTGACTCATCAAACAGCGGAAC
CTGAACAACGCCTTCGCCTACGACCTGGTCCCTTCGCCGTCGGTGCTGGTTGCCGCCTTGAAAGCTGCCCGGAGGGTCAA
CGACTACCCGACTGCCGTGCGCGTCTTTGAGGGTGAGTGTTTCTTTCCGCTCCGGCTACCTACTTCCTCCTGCGCATGCC
GTTACTGATTCATTATCCCCCACCAGGCATCAAGGCCAAGGTCGAGAACAAGGGCCAGTACGAGCAGTACCTGGAGGAGC
TGAAGCCCCTGCGGGAGGAACTGGGCATTGTGCTCAAGGAGGAGCTGTTCCCCGAGGAGACGGCCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62