GenePrediction:GLEAN_6315 Details

Name: GLEAN_6315
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:864393..860571 (- strand)
Length: 3823
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:864393..864367 (- strand)
Length: 27
Type: CDS
Source: GLEAN
Position: GCSC_144:864206..862993 (- strand)
Length: 1214
Type: CDS
Source: GLEAN
Position: GCSC_144:862908..861033 (- strand)
Length: 1876
Type: CDS
Source: GLEAN
Position: GCSC_144:860978..860571 (- strand)
Length: 408
>GLEAN_6315 class=GenePrediction position=GCSC_144:864393..860571 (- strand)
ATGCCGGACCTGCACCGTCAGCCCCCAGTACCATGATGTGGTAGTGCCCCGGAAGAAGCGCTTTCCCGTGGCTGTCAGTG
GCTGGACCAAGAACCGGAGCTGGCGTCGGAGCCGTTCGTATGATGCCTAGACATGTGCGTCTTATCCCAACGACAGACTG
TCCGTTCCGACCTGCTAACATTCACAGAAGAATTATGGCCAGTTTATGCCGGTCGATAGGATTAACAGCACCACCGAAAC
ACCCAAAGTTCTCCAGAACTCGAGCTCCAAGCGGCGCGAACAGATCGAGCAGCCGCCACATTCGACACCACCTAAGAGAA
GGAGAATAGAACTGTCTCCATCGATGACCCCGCGGTCCGCCCGCACCGCAGAGGCCGGCTGGACGCGTTCCCCCTCTCCC
AAGGGACGGCCCTCGTCAAGCAACCTGTCGGCGACCAGCAACCGGATAGCAAGCAGCACCGTGGCCGAGTTGCGGCTGGT
CGACACATCCACACGCATCCAATCGCGGCGGCGGCGGCGACGACACGGGCGCGGCGGCGAGGACGCTTTTTCGGCCATCA
CTCTGCCTCGTGGCATAATTGTTGACGATGTGGACAAGGATGAGAACGGGGACGAGGACGGGGAGAGTGCCGTGGAGGTG
GTATCTTCCAGCAAAGCAGCGCCGAACCACCGGAACACAAACCTGACGATCGAGATTCGTGATTCTTACCCCCGGAATCG
CATTCGCGATCGTATGATGGACCGGTTGCCTAAGAACGCCGCTTTGTCCAGGCCGTGGCAGCCGCCGGCTGAAGCACAGC
CGGGCGGCGTAAAGAGGACCATACACAACAGTTCGAGGAGCGGCAACGAAAGTGCAGACGAGCTGTCCAAGGAGTATTTC
TTCGACCGTCGGTCCCGGAAAACGAGCAAGTCGCCCGCTCAAGGCATCAGAGTTGCCGAAGAGAAGAGGGTGAACGCACC
TGATTTGCCTGCAGCCAAGATGTCTGTGTCTTCGTTTGTTCAGAGCCTGATCGACGTGCCCCTGCAAGTATCTGCTGCCT
TTTGCTACCCGTCTCATTCCTTCGTATCCAGTGCGATCTCGGAGGAGGGTAATCTTAGCATGACGGTCGATCCACAGCTG
TCTTATGTTGTACGGCCGACGGATGCCTCTTCCGCGCGAAATGAGAAGCTGTCCTGGCTGAAATGTAGCTTGGTCCGAAC
CAACGCGCTCAAGTACAACAAGCTGTCGCCCGTGGTTCTCTTTGACATATCACAGCGAGGCCAGCTCAAAGATGGCCAGC
TTGAAGACGGCCGGCTGGGACCACTGATGGGGATAAGATTCAAAAAAGTCAAGGATGCGGCAAGGCTGATCGCTTGGGCA
GCCAATTGCTCAAACTATGTTCGACTCGTAGAGGTTCAGGCGTAAGTGCTTTTACTACCGAATCGGCTTATTCCGTGGCA
CCAAGACAGGATCATGCTGACAGCTTTCTTCTACCCTCGCTTCAGAGACAAGGTATGGCGAGCATTTGACAACGCGCTGA
ACACTGCCAAGGAAGCGGGCCAGAAGCCAGTTCCCAACGACAGTGTAGATGTCCTGTCCTTGGATGCCAACGACAAGCCG
TTGACAGGACAAATATCGGGCGCCTTGAGCTCTCCTTTGGATGAAAGCCAAGAGAAAACGATCATCGCAACCGCTGTCAT
GTCATCGCCCACGCAGAAGAGTACGGAGGAGCCGGTGATCCGAGCTACCAGACAAAGGGCAAGTCTTGGGGCAGCAGAGA
CGGTCGATCTTGAGGATCCTGCTCTTGGGGGAGACTTAAACAGCTGTCTGGAAAATCGACGCAGCAGCAGAAACAAACTT
TCGCAGTTTGGCACCGGCACAGCCGAGTTTGGGCTAGAACCTGTCAAGCGATGGACGGAGGAGAACCCTGACTGGGCCAA
GGACTGGAGGATTCCGCTGACGTATTCTCGCACAACGGTCGACAAGGATGATGTGGCGCGGCTTGACGAAGGCGAGTTTC
TCAACGACAACGTGATCAACTTCTACCTGCAGTTTCTGCAGAACACGCTGAAAAGGGGAGAGTCGAATCTTGCAAAGCGG
GTGTACTTTCACAACACATTCTTCTACGAGAAGTTGAAGCCCAAGAAGGGCAGGGCGATCTCGTTTGACGGCGTCCGAAG
GTGGACGGCCAAGATCGACCTGTTTTCATACGACTACATTGTGGTGCCGGTCAACGAGCATTCCCATTGGTGGGTGGCCA
TCATGAGCAATGTACCGAAACTTGTTGCCGAGTCAATGCCGAAGGACGAATCGGAGCCTGACGTGCCAGAGGATGCGGAT
GCGGCGGCCATTCCAGACGCGGGTGCTAAGAGCGACCCTCCGACAAGCGTGACCGTGGATGACGAGCAGGCCGAGTGCAG
AGAAAAGGGCACCGAAACAGCGACTGGCGGCACCGAAGAGGGCGGGGCATCGGAAGACGTCATGCCCGAGTCAAAGGACA
AGACAACGAATACGGTCCGGTTGGGTGATGGCAATGAGGCCGATGGCAACGGCAACGACGATGACGACAACAGCGATGAC
GACGAGGTGACGGAGATCAAGAGCGACATCATAGCAGTGCCGCCTCGACGGACAGCGTTCAAGAAGTTGAGCAAGGGACA
AGTACGGAAGCTGTTTATGAAGAAGACCAAGAGCCAGGACCCGAAAGCGGCGCGAATTGTGACGCTGGACTCGCTCGGAA
GCCCGCACAGCGTGTCGATCGACCACCTGAAGCAGTGGTTGCTAGCGGAGATGGAGGAGCGAAAGGGCATCAAGCCATCG
CATGCGGCCGGGCTGGGCATGACGGCCAAGACGATCCCACAGCAGGAGAACTTTTGCGACTGCGGCGTGTACCTGCTGCT
CTACGTGCAGGAGTTTGTCAAGGACCCAGACGGGTTCATGGAGGACATGGTGCTGCACAACGAGCGGCAGTGGGACACGT
CGGCGCCAGAGATGCGGCGACAGCTGCGCGATCTGATCCTGCAGATGCAGAAGGAGTACCAGGCGGCCGAGGAACAGGCC
AAGCAGGCGCGGAGGAGAAACGGCCAGAACGCGGCCACAGCAGCAGCACGGACGAAGGCGGCCGCGAAGGCGACGATGGA
CATGGCTGTCAACACGGCAGCAGCTGACGCGAATGCAATTGTGGGAGGCAGTCCTCCGGGGGAACAGTCCTCCTCGCCGT
GCATATCGACATCGCCTCCACGGGCAGACATGACGACTGCGGCCAATCTGTCCGCTACGGCTGCTCCTGCGGACGGCAAG
GAAGCAGGCTGGCTGTGCCAAAAGCCGGGCGACAGACCGGGATCGTCTGCCTCGTCGTCTATCGGCCCGGCCGAGGCAGG
GGTCACATCTCCGTTCAAGGAGGGATCGCCCAACGAGTTTGCGCCGCAACGGTAGAAACGTGCTGCGGCGACCGAAGATC
TGCCATCGCAGCTCAGCGAAGAGAGGCCTGAGTCTGAGGAGGTCGATTTGGTTCAGGAGAGCTTTGCTGAAGAGCCAGAA
CGCTTTCTAGGACAGGAAGCATGGAAGGACGACGATGTCGTGTTGATAGGGTCACGGCCGTGCAGCTTTGCGCGTCGGAC
TGATTTTGCAGCGGACACCACGACTGCTGAACAGCTGACGTCCACAGACGAGCAGCTGAGTTTTTTGCGAGACAAGTTTG
ACCTTCCGGTTGAGCGGTGTCTGGGCTTTGTCAGCAGCCGGCACGTGGTCCCGTCCGAAGCGGTGTACAACTATAAGAGG
CTGGCCTGCGTGAACGGGTCGGAGGACTACGGCAGCGATTTGGACTTGGGGGGTCTGGACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62