GenePrediction:GLEAN_6316 Details

Name: GLEAN_6316
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:857586..856743 (- strand)
Length: 844
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:857586..857581 (- strand)
Length: 6
Type: CDS
Source: GLEAN
Position: GCSC_144:857507..857354 (- strand)
Length: 154
Type: CDS
Source: GLEAN
Position: GCSC_144:857270..857021 (- strand)
Length: 250
Type: CDS
Source: GLEAN
Position: GCSC_144:856959..856743 (- strand)
Length: 217
>GLEAN_6316 class=GenePrediction position=GCSC_144:857586..856743 (- strand)
ATGTTTGTGCCGCTGCCGCCGCCTCTCCCAACCGAGGCGACCATCGCCGGTCCGGAGCTAATGCTACTTGTCTAGGGAGG
TCTTGCTCGGCATCACGGGCAAGGACTTTACCTTGGTCGCCGCCTCCAAGGCGGTCATGCGAGGCCCGACCATCATTGCG
GCGCGCGATAACAAGACTCGCCAGCCCAACAAGCATACCCTGCTCGCCTTCTCCGGCGAGCCTGGCGACACTGGTGCGCA
TTTCTGTGCTCACAATCTTTCTTTCTTTGACCCGAGCTGACCCTCTGCTCGTGCCTCTCGCTCCCCTCGCCTGCAGTCCA
ATTTGCCGAGTACATCCAGGCCAACATCCAGCTCTACACCATGCGCAACGCGGCCGAGCTGTCCCCCTCTGCCGTCGCGC
ACTTTGTCCGCGGCGAGCTGGCCTCCAGCCTGCGCTCAAGAAAGCCATACACCGTCAACCTCCTGCTGGGCGGCGTCGAT
CCCATCACACACAAGCCCAGCCTGTACTGGATCGACTATCTTGCTTCGCTTGCCCCCGTGCCCTATGCCGCTCACGGCTA
TGCGCAGTACGTCCATTCCCCGTTTGCACCCTGTGTATCTCTGCTATGCTGACCAGCGCCCAACCAGATATTACTGCCTG
TCCATCCTCGACAAGCACCACCACCCCGACATCACGCTCGACCAGGGCATCAAGCTCCTCAGCATGTGCACCGACGAGCT
CAAGCGAAGGATGCCCATCGATTTCAAGGGCATGATTGTCAAGGTCGTCACAAAGGACGGCGTCATCGAAATTGACACCG
ACGAGGTCAATGGAAAAGATGCAAAGCCCGTTGTAATCCCTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62