GenePrediction:GLEAN_6317 Details

Name: GLEAN_6317
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:855215..852995 (- strand)
Length: 2221
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:855215..854959 (- strand)
Length: 257
Type: CDS
Source: GLEAN
Position: GCSC_144:854879..852995 (- strand)
Length: 1885
>GLEAN_6317 class=GenePrediction position=GCSC_144:855215..852995 (- strand)
ATGGCTGATCAACTCAACATGAACGGCCTTAACATCGGCCCCAATGGCGGAGCGCACACCCTGCAGCGGTCTTACATCCC
ACCTCATATGAGAGGAAAGGTGGCTGCTAATGGCAGTGCGCCCGCCCCTGTTGCTGCCGAGGCTGCCCCTCCTGTCAATG
CGGCCGCTCCGGCTGCTGCAGGCCCTGCTGCCACTGGCCCGGCGCCCACACCTGCCGGTGCTGCTGCTGCTGGTCTCAAC
AACAGCGCCTGGTCTGGGTATGTTCTTCTGCGCGGACTGCGCTTGCCCTTTCTCTGTCTCCCTTTTTGTGGCCCAATCAC
TAATGCGCAGAAACAGAAACCAGAACGTGAATGCCCGCCCCGCAAATGGCTGGAGCGGTGGAGGACAGCAGCGTCAGGGC
TGGGATCGGCCTCAGAGCTTCAACCCCAACGCATACGGCGGTGCTGGCGGTGCTGGCGGTGCCGGTGGTCCTGGTAGTGC
TGGCGGTGGCCACGGCGGCCACGGTGGTGGTGGCCACGGTGGCGGCGGTGGTGGTGGCGGTTACGCCCGTGGGTCTGGTG
ATGGCCAGTGGCGCGATGGAAAGCACATTGCCGGTCCGGCCAACCCTCGCGTGGAGCGGGAGTTGTTTGGTCTGCCGGAT
GATCCGTCGAAGCAACACACCGGTATTAACTTTGAAAAGTACGACGATATTCCCGTCGAGGCATCGGGTCATGACGTTCC
CGATCCCGTTCTCACATTTACCAACCCTCCTCTGGATGACCACCTGATTCACAACATTGAGCTTGCTCACTACAAGGTGC
CCACTCCGGTTCAGAAGTACTCGATTCCCATCGTCATGGGTGGTCGCGACCTCATGGCCTGTGCTCAGACTGGTTCTGGC
AAGACTGGCGGTTTCCTCTTCCCGATTCTGTCCCAGGCTTTCATCACCGGCCCTTCTGTTGTGCCCAACGGCCAGGCCGG
TAACTTTGGCCGTCAGCGCAAGGCCTACCCCACGTCTCTGATTCTCGCCCCCACCCGTGAGCTGGTGTCTCAGATCTACG
AGGAGTCCCGCAAGTTTGCCTACCGCTCGTGGGTCCGACCCTGCGTTGTGTACGGTGGTGCCGACATTGGCTCTCAGCTT
CGCCAGATTGAGCGTGGTTGCGATCTCCTGGTGGCCACGCCTGGCCGACTTGTTGACCTCATAGAGCGAGGCCGCATCTC
GCTGTGCAACATCAAGTACCTTGTGCTTGATGAGGCTGATCGCATGCTGGACATGGGTTTCGAGCCCCAGATTCGCCGCA
TTGTGGAGGGCGAGGATATGCCGGGTGTGAACGAACGTCAAACCCTGATGTTTTCCGCCACCTTCCCTCGCGACATTCAG
ATGCTGGCCCGTGATTTCCTCAAGGACTACGTCTTCCTTTCCGTCGGCCGTGTCGGTTCGACTTCGGAGAACATTACCCA
GAAGGTGGAGTACGTGGAGGACAACGACAAGCGCTCCGTGCTGCTCGACATTCTTCACACCCACGGCGCCGGCTTGACGC
TGATCTTCGTCGAGACGAAGCGCATGGCCGACTCGCTGTCGGACTTCCTCATTAACCAGAACTTCCCGGCCACATCCATT
CACGGCGACCGTACGCAGCGCGAGCGTGAGCGGGCGCTGGAGATGTTCCGCAACGGTCGTTGTCCCATTCTCGTTGCCAC
TGCCGTTGCTGCTCGTGGTCTTGATATCCCGAACGTCACGCACGTTGTCAACTACGACCTGCCCACCGACATTGACGACT
ACGTCCACCGTATCGGTCGTACTGGTCGTGCGGGTAACACTGGTCTGTCGACGGCCTTTTTCAACCGTGGCAACCGTGGC
GTTGTCCGCGAGCTGATTGACCTCCTGAAGGAGGCCAACCAGGAGGTCCCTGCCTTCCTTGAGACCATTGCTCGCGAGAG
CTCCTTCGGTGGTGGTGGCCGTGGTGGCCGCTCTGGTGGTGGCCGTGGTCGCGGCCAGAGTGCCAACCGCGATTTCCGCA
AGCTTGGAGGTGGTGGCTTCGGCGGCAACACCGGTGGCGGCGGCGGCGGCGGCTTCGGCGGCTCCAGCGGCGGCGGCGGC
TATGGTGGCAGCAGCGGTGGTGGCTACGGCGGTCCGCCGCAGAACTCTGGCTATGGTGGTGGTGGTGGTGGCAGCTACGG
CGGTGGTGGTGGCGGTGGCAGCTACGGCAACCCGGGCGGCCCTGGTGCCTCCTGGTGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62