GenePrediction:GLEAN_6318 Details

Name: GLEAN_6318
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:851289..848701 (- strand)
Length: 2589
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:851289..851283 (- strand)
Length: 7
Type: CDS
Source: GLEAN
Position: GCSC_144:851135..851093 (- strand)
Length: 43
Type: CDS
Source: GLEAN
Position: GCSC_144:851027..850696 (- strand)
Length: 332
Type: CDS
Source: GLEAN
Position: GCSC_144:850637..850540 (- strand)
Length: 98
Type: CDS
Source: GLEAN
Position: GCSC_144:850485..849056 (- strand)
Length: 1430
Type: CDS
Source: GLEAN
Position: GCSC_144:848986..848701 (- strand)
Length: 286
>GLEAN_6318 class=GenePrediction position=GCSC_144:851289..848701 (- strand)
ATGCCGGGTGAGTTGCTTCCTGGTTTGCCGAAACTCCCTTTTGGTCTCGTTGCTTGCAGAGCGTTGCCGTCTGAGGGAGT
GGTGCACATGGCAGAGCTTCGCTACAGTCGACCTGCTCCTGTGATGGATAAGTGCTAATGCCATGGGAGCACAGGTGTGT
TGCCGTCTGAAGACCCCTGGGTCGGACAGCAGATTGTGTAAGTGTATCTCGACCGGATGGCATCTGGTGGCTGCCTCGCT
AACCTTCCTCTCCCTGTTCCAGCATGTCTGACCTGTCCGAGATCGAGGGGTGCTCCATTGCCGTCGATGCGACCTACTTT
ATCCAAATGATGCTCGATGCCGGGCCTGCGCGTGAGCCGCTCATGGCTGCCTTGGGGGGAATTACTGGATTCCAGAAGAA
CCTGGGACTCGAGCTCGACCAGTGGGCTGCCAACAACGTGATCCCGTTCTTCGTCTTTGATGGCCAGCCAGTGGTCGGCC
AGGAAGACGTTGCCATTGAAGAGGGCCTCCGCGACATTGCCAAGACTGATATCGCATGGGAACTTTATTTCGGTAGCCGT
GCTAGCGAGGCAGTGATCGCGTTTGGCGAAGGATGTAAGTCTGGGAGGATTGGGTCACCGTCTCTTTCTTCCTGCTTCTG
ACTTTTGCCAAGCCACCTTCCGCATCCAGACTCTCTATCCTGTTCTGCAGCGGACTCTCAAGGCGAGAAACTTGCACTTC
ATCACTCCGCCATACAGTGCAGCTGCCCAGGTGAGTTGCTGTCTGCAAGCTCGCCTCTCGCCACTCTGCTGACACTGGAC
GAAGCTTGCGTACTTTGATATGGTCGACTCGGAACAGTGCGCCGGAATTATGGGCCAGCAAGAGCTTCTCTTGTACCCCA
TCCACGACTGCATTATCCGGGCCATAGACTGGGAAACCAACAAGGTCACGTACATTTCGAAGAAACAGATTCTCAGGAAC
CTGAACGTGAGCGAGCCCATGTTCATTGACGCCTTTCTCATGACTGGCTCTTCATTCCTGCCCTCGTTTCCTCCTCTGCG
GGACGGCACCACCTATCCTCGACAGCCCAGCGTGATGGATGCGTTAAACATGCTGCGTACTGCGGACAAGAATATTGCCA
ATTTGTGTGCGTCTTTCCACGACGTTCTTCAGGCCCAGGACCCAAACTGGTTGGACAAGTTCCGCAAGGCTCGCATGGTG
GTAGACCACTTCATCTACGTGGCCGAGTCCGGTGAGATCCAGGTCTACGACTTTGAAAAGCTCACGAAAGACAACCACCT
CTATCTGGGCCTCCAGCTCCCATCGGAGCTCTTCCATTACCTCAACACTGGGCTCGTTGGCCCGGAGGTGCTGAGCTGGA
TTTCGCATGGTCAAATCACCATCCTGCCGACATTGGAAGGCTATGCGAGCCCAGAGTACCGCGAGCTGGTGTCCAAACAG
CTTGTTCCCTACTACGAGACCGCTCTGGGCTTAGTCATCCCCCGTCTGAACCGTGGCCTGCAGTTCCGAGACATTGTGCT
GAAGGTGTGGTACGACAAAGGCTTCTCGCTGAGCATCAACCACCGGAATGAAGGCAACTCGCCGGCATCGCGGGTCGAAA
AATGGAACGTGACGGGGGAATCTCTGAGCACCCATTTCCCCAAGGCCCAATCAGGCACCATTGCCTTTGAGCTGTCAGCC
TTTGCCAACAAGGACTTTATCGCCAGCACACTGAATGCACGAAAGGCAAAGGGATTGGAGTCGGAGGACGCCATTGTCTC
GCTCTCGATCTGGAAGCTGCTGACGCTGAACGGCTACATCAAGGAGAAGACGCTCGAGCTGACTGCGTGGGGTACAGCTC
TGGCAAAGACGCTGTCTGCCCTGGAACCACTGGCAGCAAAGGCGCCCGATCCGCTGGCGCTCTTCCACGCCGCTCTTCTT
TCGTATGAGCTGATCAGGTTGGGACTACTGACGACCGGCCACAGACAGGCCGAGCTGCAAGGCTGGCCGGTAAACGGGAG
CGAGGAAGACAAGAGCTGTGTTGTCCTGATCAGCCGGGTGGCCACACTGCTGCAGCTGAGGCAGGATGTCTCTGGCTACA
CAGGGCCTCTTAGCAAGAATCTTCTGGCCTTTCACAGCATGACCGTGGCGGTGGGCTCGGCGAATCGGAACGTGATCGAG
GCGTTGCTCGCCAACACGTTCATGTCGGGCCAGGCTAAACGGAGCAAGCTGGACAATTGGAAGATCAGCCATCGGTACGT
GAGAGTCCAAGAGTCCCCCTTTACAGCTGTTTGTTCTGCCCCTAACGGTCCTTCCGACTCTAGCCTCCCGTTCTACGAGT
TCCCCGATGCTGCACTGTCGATCGCCGTCAAGACATTCCTAGACGAAAGCACGTTTGACACGACTCCGGAGCAACGACAG
CAGCGTCAGAAGGAGTTCCCGGAGAACTTTATACCGCGCGCGCTGAAGCCGTTTGAGGATTTCGACATGGTCTTCGGTCT
CGTAGACGCTCTGCATGCCGGCGTGGGGACGCTGGGCGACAGCGAGATGAAGGCGGATGTCAAGGCGGACTGGGACAAGG
CCAAGAAGTATTTGGACCGCAGACGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62