GenePrediction:GLEAN_631 Details

Name: GLEAN_631
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1100855..1102410 (+ strand)
Length: 1556
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1100855..1101221 (+ strand)
Length: 367
Type: CDS
Source: GLEAN
Position: GCSC_97:1101279..1101373 (+ strand)
Length: 95
Type: CDS
Source: GLEAN
Position: GCSC_97:1101460..1102410 (+ strand)
Length: 951
>GLEAN_631 class=GenePrediction position=GCSC_97:1100855..1102410 (+ strand)
ATGGCAGCCAATGACAAAGCACCGTCGACCTACCGGTACGATGAGAAGCCGGTGTATACGACATCCAATGGATGTCCCAT
CGACAGCCCAACCAAATACCAGCGTATCAGCAACGGCCCGCTACTGCTTCAGGACTTCCACCTGATCGACCTGCTGGCAC
ATTTTGACCGCGAGCGCGTCCCAGAGCGTGTGGTCCACGCCAAGGGAGCCGGAGCGTTTGGCGAGTTTGAGCTGACGCAC
GACCTCAGCGACATCACGTCCATCGGCATGCTGACGGGAGCTGTGGGCAAGAAGACGCCGCTGGTGGCCCGGTTCTCGAC
CGTGGGGGGTGAGAAGGGCTCGGCCGACTCGGCGCGAGACCCAAGAGGTGAGAGGGCGTGGTTTCTGTCTGTCTTTCCGT
AGCTAATGCTCCGGTCTCTCCCAGGCTTCTCGCTCAAGTTTTACACGGACGAGGGCAACTGGGACTGGGTGTTCAACAAC
ACGCCGGTCTTCTTCCTGCGGGACCCGACCAACTTCCCGGTGTTTATCCACACGCAGAAGCGCCACCCGCAGACGAATCT
GAAGAACGCGACGATTGTTTCTGGGACTACCTGTCGACGCACCAGGAGGCAGCGCACCAGGTGATGCATCTGTTCTCGGA
CCGCGGCACGCCGTACTCGTACCGCCACATGAACGGCTACTCGGGCCACACGTACAAGTTCACCAAGCCGGACGGCAGCT
TTGTCTACGTGCAGGTCCACGCCAAGACGGACCAGGGCAGCAAGACGTTTGACAACGAGACGGCCGGCAAGCTGGCGGGC
GAGAACCCGGACTGGCACACGCAGGACCTGTTCGAGGCGATTGAGCGTGGCGAGCACCCGAGCTGGACGGTGTACGTGCA
GGTGCTGACGCCGGAGCAGGCCGAGAAGTTCCGGTGGAACATCTTTGACCTGACCAAGGTGTGGCCGCAGGGCGAGGTGC
CGCTGCGGCCGGTCGGCCGCTTCCGGCTGACGCGCAACCCCGAGAACTACTTTGCGCAGATCGAGCAGGCCGCTTTCTCG
CCGTCGCACATGGTGCCAGGCGTCGAGCCGACAGCCGATCCGGTCTTGCAGTCGCGGCTGTTTTCGTATCCAGACACGCA
CCGCCACCGTCTCGGCACCAACTACCAGCAGATCCCGGTCAACCGGCCGCTGCGGGCGTTCAATCCGTTCCATCGCGACG
GCGCCATGGCCGTCGACGGCAACTACGGCGCCAACCCCAACTACGAGAGCTCGTACCGCGCCTTGACCTACAAGCCGATC
GTGCCCACAGTCGCGGCCCACGAGAAGTGGGTGGGTGCCGTGTCGTCGGCCGTGTTCGCCGACGTCTCCGACGAAGACTT
TGTGCAGCCCAACGCGCTCTGGAAGGTCCTTGGCCGCACTGCCGGCCAGCAGGACAATTTTGTCCACAATGTGGCCGGCC
ATCTGTCGGCGGCCAAGAAGGACACGCGCGAGCGTACGTACGGCATGTTTTCCCGCATCGACGCCGATCTGGGCCGGCGG
ATCAAGAAGGAGACCGAGGCTGAGGCGAACAAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62