GenePrediction:GLEAN_6320 Details

Name: GLEAN_6320
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:836994..835726 (- strand)
Length: 1269
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:836994..836598 (- strand)
Length: 397
Type: CDS
Source: GLEAN
Position: GCSC_144:836537..836444 (- strand)
Length: 94
Type: CDS
Source: GLEAN
Position: GCSC_144:836254..835726 (- strand)
Length: 529
>GLEAN_6320 class=GenePrediction position=GCSC_144:836994..835726 (- strand)
ATGGATCAACCCACATCTACGGCAACGGCTCTTGCCAGCCACAAGCTGATCCTCCTCAGCCCGTTTGCGCTTCCGGATGA
CTGCGTCCCCACGCTGACAAAGACTTTCCCGGGACTCGAGGTGGTCGCGCGCTATCAGCCATGGGATAGACAGACGACAG
ACCTGCCAGAGGAGGAATGGCGGGATGCGACGATCCTGGCCACGGGCAGCATGCTGCCTGATGCTGAGCTGGCACCCAAG
TTGCAGTATGTTCAGCTATTCAGCGCCGGGGCCAACCACCTGGCCGAGCACGCCGTGTTCAAGGACCACAAGGTCGTCTT
TTGCGGCGCCAACGGCGTTCACGGGCCGCAGATTGCAGAATGGGTCATTGCGACCTATCTGAGCGCCAAGCACAGATGTA
CGTGTGCTGTTCTGTGCTGGTTGTCTGTGCTGATGTGCCTTGCTGACTCATCTTCAGTGGCAGAGTATCGCCAGCTGCAG
GAGCAGAACGAATGGCGCCATAACAGCAACAACCTGGACGAGGCTGTGGAAGACTCTGTTGGGCGCTGCGTGTGAGTGCT
ATTGGAAGAGACGGGCAGCCTCTTGCATGGTCGCTGTGCTGATGCTCGTTTCTCCCCCTTCCCCCCCTTTCCACAGAGGC
ATCCTCGGCTACGGAGCCATCGGACGACAGGTAGCCCGGCTGGCCCGGGCTCTGGGCATGAAGGTGCACGCCTACACGCT
GAATGCACGAACGACAGCAGAGTCGCGGCGGAGAACGACGCGTACCAGCCGCACGGGCTGGGCGACCCGGCCGGCGACCT
TCCGGACCGCTGGTTTGCCGGCACGACCAAGGCCGATGTGCACGCCTTTCTCGGCTCTGGTCTGGATCTGCTCGTCGTCG
CGCTGCCGCTGACAGATCGCACGCGCGGGCTCATTGGCGCCGACGAGCTCGACCTCCTCGCCCGCCATCGGCCTGCTGGC
ACTAGCTCTGGCTCCGGCTTCTTCCTCTCCAACATTGCGCGCGGCGCCGTCGTCGACACGGACGCGCTCATCGCAGCCCT
CAACGACGGCCGCATCGCCGGCGCCGCCCTCGACGTCACCGACCCCGAGCCGCTCCCCCCCGGACACCCGCTCTGGTCGG
CCAGAAACGTCACCATCACGCCGCACGTCAGCGGCAGCTCGACGCGCTACCTCGCTCGCGTCCTGGACATCCTTACGATC
AACCTGGGCCGACTCCGGGCAGGACAGGCGCTGCTGCTGAACCAGCTGGACAAGAAGGCCGGATACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62