GenePrediction:GLEAN_6322 Details

Name: GLEAN_6322
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:828827..826850 (- strand)
Length: 1978
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:828827..828685 (- strand)
Length: 143
Type: CDS
Source: GLEAN
Position: GCSC_144:828620..826850 (- strand)
Length: 1771
>GLEAN_6322 class=GenePrediction position=GCSC_144:828827..826850 (- strand)
ATGATGGACGACATGAACATGTCGATGAGCTCGTGGCAGCCGACAAACATGAGTCTGGCCCGGATATATTGGTACATCAT
CGCCGGCATCGTGGGAATGCTAATGGTTGTCCGTGGAGTCAACTACTACCAGAACTCTTTGAGGTACGATGATTTTTGCT
TTATTCTGTGACCTTTTCCTTTTGTCTGTCTCTGTCTAACCCTCCAGACTACGCACGCTTGCATCCAGCTCCCAGCAGTT
CCCGACAAAGCCTGCCAATGGCTTCCTGCAGGCGTGGGCAACTCTCACGGCAGTCGGCCGTGAGGTCAGCTACCCGCAGC
TGTACGTCCCTGTGCGCTACCTTGGCTGGCTGACCCCCCCGCCAGCTGGCCGGGTCCTCATCCTGCTCGTCTACTGGTCC
GTCATCATCGGCTTCATGACGGCCGGCTCCATCGTCAAAGACGTCAACTTCTGGGAACGCATCGGCTTCCGCAACGCCTG
GGTCACGGTGACGCAGCTGCCACTCCTCTACCTGCTCGCCGGCAAGTCGTCTGTCATCGGCACGCTGACCGGCTCGTCGC
ACGAGCGCCTCAACTGGCTGCATCGCTGGGTCGCCCGGACGATGTTCGTTACCGCCTCCGTCCACGGCTGGCACTTTTAC
TCGGAGTATGCCATCGCCGACATGACCAACCTCTTCTTCGAGACCATGCCCATGGGCAAGTACGGCGTCGCCGCTTGGGC
CCTGCTGCTCTGGGCTTTCATCTCTGGTATCGCACCGCTGCGCCACCTCTGCTACGAGTTTTTTGTCGTCCAGCACATCG
CCACCGCCGCCTTGCTTTTGTGGGTCGTCTATGTCCACGTGCCCTCGTACGCCCGCTACAACGTCTGGTTTGCCATCGCC
GCCCTGTGCCTCGACCGGCTCGTCCGGCTCATCCTGCTCGTGTGGCAGAACGTCAAGGCTCGGCCGAACCCGTCTCGCTG
CAAGGGCGGACAGCGCATCGGCCACCAGGCCCAGATCCGTGCCGTCGGCGACGACATCACCGTTGTCACCATCAAAGATG
TCCACTTTCGCTGGGCCGCCGGCCAGCACGTCTATCTTTGGATGCCTACTCTCGCTCCCCTGGAGCAGCACCCTTACACC
GTCGCCTGTGCCCACCAGCTACCCGGCACCTGCATCTGCAACAGCATCCAGCTCGTCGTCCGCAAGCACGCCGGCTTTTC
CAAGCGGCTACACGACCGTGCTGCAGCGCTGCAGGCATCCGAGAAGAAGACCACCTTCACCGCCTTTCTCACCGGCCCCT
ACGGCGCTCCGCCTCGGTCGGACATCTACGAGACGCTCATCTTGATCTCCGCCTCGACCGGCGCATCCTTCACCCTGCCC
ATCCTCGAGAGCGTCCTGCAGGCAAGACAGGCCGTCTGCACCAAGCGCGTCGACTTTCTTCTGTCGGCCAAGAAGGGTGA
CGAGATCGACTATTACGTCCGCCGGCTGCACGAGCTGATCGAGATCGCAACGGGCGTGGGCATCGAGCTCAGCGTGTACA
TTGCCGTGACCAGCGACCCCAATCACAAGTCGCGGCTGGCTGCTGATGCTACACCCCAGGAGAGAGACCAACCCGTTGCT
TACAGCAGTTCGGCATCCTCAAGGGAAACAAGTCCGGGGTCGGATGGAAACAGAAGCACCCCCGCAAAAGCAAAGCTGCT
GCAGTCAACCGACATTGAGAAGACAGCTATGCAGTGCTGCACGAAACGGCAGCGCAACGTCAGAACGATCAGCGCCGAAT
CGCGTGTGTACCAGCTGGACAGCCGTCCTGACATCGACGCCTTCATCCGAGACGCAGTGGTGTCTACGGGCGGAGAAACG
TCGGTGGTTGTGTGCGGCGGTAAGTCTCTGGTCGCAAAGACAAGAAACAGCGTTGCCCGGCTCTCGGACGAGCGCGCTGT
GCACAAGGGAACGGGCGCCCAGGGGATTCATCTGCATGTCGAGGAGTACGGGTTTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62