GenePrediction:GLEAN_6323 Details

Name: GLEAN_6323
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:826566..824136 (- strand)
Length: 2431
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:826566..825798 (- strand)
Length: 769
Type: CDS
Source: GLEAN
Position: GCSC_144:825730..825552 (- strand)
Length: 179
Type: CDS
Source: GLEAN
Position: GCSC_144:825483..825097 (- strand)
Length: 387
Type: CDS
Source: GLEAN
Position: GCSC_144:824949..824621 (- strand)
Length: 329
Type: CDS
Source: GLEAN
Position: GCSC_144:824556..824136 (- strand)
Length: 421
>GLEAN_6323 class=GenePrediction position=GCSC_144:826566..824136 (- strand)
ATGCCCTCTCCCTCCATTCTTGCCGCTGCTGCTGCCACCACCCTCTCGTTCTGCACCCGACGCTCCCCCCGACTCATTAC
CCGCACCACAGCCGCCAGCACATTTCGGCAGCTTCAGCACCGAGCCGTCGTTCCGCTCTCTCCAGGCCCCCCAGTCTCTC
CCGTCTCTCCCGTCTCTCGCACCTTTCCTGCGTGGAAGTACCGCAGCCGCGCCTTCACCATGTCCGCGCCGTCAGCTGCG
GCCGAGCAGCTGACCAAGCTGGTTGCCGGGCTAAATCTGGGCGATGCCACCGACAAGTACCCCAACTGCCATCCGACGAC
GAATCCGTTTGATCTCTACCGGGCCCACCTGGCCAACACGCTGGCCACGGTGACGGGTGTGGCGCCGGCCATTGTCTACC
CGGCCTTGCAGTGGACGACCGGTCTCGACAAGGGCGACCTCATCCTGGCGGTGCCAGCGCTGCGGGTCAAGGGGCGCAAG
CCGGACGAGCTGGCCAAGGAGTGGGTGGAAGCGTTCCCGACCGAAGATGCGCTCGTCGAGCCACCGACGGTGACGGGCTA
CTTTATCCAGTTCTACTTCAAGCCTGGCCCGCTCGCCAAGCTCACGCTGCCGACGATCTTGCGGGAGGGCAAGGCGTTTG
GCAACGACAAGACCAACGGCCTGCAGGACCCCAAGGACGCCAGCAAGGGCCGCAAGCGGCTCGTCGTCGAGTTCTCCAGT
CCCAACATCGCCAAGCCCTTCCATGCCGGCCATCTGCGCAGCACGATCAGTGAGTAGCGTTCCCCGACCAGCGCGTTCAG
CTCTGCTGGCGCACCTGCTGACGAGATGGACTTCAGTTGGCGGCTTCCTCGCAAACCTGCACGAGGGCGTCGGCTGGGAT
GTTGTGCGGATCAACTACCTGGGCGACTGGGGCAAGCAGTATGGCCTCCTGGCGCTGGCGTACGAGCGCTTCGGCGACGA
AGAGGCGCTCAGCAAGAACCCCATTGCCCACCTGTTTGACATTTACGTCAAGATTGTCTGTCTTCCCCTGTCTGCTGTCT
ATTCTTTGCTTTTTGCCTTCGTTGCCATGGCTAACCAGCACAGAATGCTGCTATGTCGGAAGAGAAGGACAAGATCGACG
CGCTGAAGAAGGAGGGCAAGACGGACGAGGCACAGAAGCTGCTGGATGCCAGCCTGGACGAGCAGGCGCGCCAGTACTTC
AAAAAGATGACGGACGGCGACGCGACGGCCGTGGCGCTCTGGCGGCGCTTCCGCGACCTGTCGATCGTGCGGTACAAGGA
GACGTACGCGCGGCTCAACATCCGCTTTGACGACTACAGCGGCGAGTCACAGGTGCCGCAGGCGTCCATGGACCGATCGG
CTGCCCGCATGGCCGAGCTGAACATCACCGAGGAGTCTGAGGGCGCGCTGATTGTCAACTTTTCCAAGCACGTTCCCGGG
AAAGAGGGCAAGCGACTGGAGCGGCCGCTGGTGCGCAAGCGCGACGGCACGGCGCTGTACCTGACGCGCGATATCAGCGA
GCTCCTTAACCGGGTGGGTTTTATTTTCTTTCTTTCTTTTTTATTTTCTTTCCCTTTCTTCTTTCTTCTCTCTCCTTCAC
CCTGCTGACCGAAACAGGAGGAGAAATACCATTTTGACAAGATGATCTACGTCGTGGCCTCGGCCCAGGACCTGCATCTC
AAGCAGCTCTTCAAGATTGTCGAGCTGATGGGTTACAAGGAGATTGCCGACAAGTGCTCGCACGTCAACTTTGGTCTGGT
GCTGGGCATGAGCACGCGCCGCGGTACCGTCAAGTTCCTCGACGACATCCTCCGCGACGTGGCCGACAAGATGCACGAGG
TCATGAAGACCAACGAGGTCAAGTACTCGCAGGTCGAGAACCCCGAGGCCGTGGCCGACGTGCTGGGCATCTCGGCCGTC
ATGGTCCAGGACATGACTGGAAAGCGGTGGGTCATCCATCCACCTGGACACTTATGCGCTGAGAAGCTGACTAATCATAT
CCCTTTTCAGCATCAACAACTACACCTTTGACATTGCCAAGATGACCTCCTTCGAGGGCGACACCGGCCCGTACCTGCAG
TACGCCCACGCGCGCGTCTGCTCGATCGAGCGCCGGTCTGGCCTCTCGCACAGCGATCTCGAGACGGCCGACACGACGCT
GCTGGCCGAAGCCCATGCCACCAACATCATCCGCCTGCTGGCCCAGTGGCCCGACGTCGTGCAGAACACGCTCAAGACAC
TCGAACCCACCACCGTGCTGACGTACCTCTTCAAGATGACCCACGCCCTCAGCTCGTCCTACGACCATCTGCAGGTCATC
GGCAGCGAACCCGAGCTGCTCAAGGCCCGCATGGCTCTCTACGGCGCCGCCCGCATCGTTCTCGGAAACGGCATGCGCAT
CCTCGGCCTCAGCCCGGTCGATCGGATGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62