GenePrediction:GLEAN_6324 Details

Name: GLEAN_6324
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:819303..818122 (- strand)
Length: 1182
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:819303..819152 (- strand)
Length: 152
Type: CDS
Source: GLEAN
Position: GCSC_144:819088..818122 (- strand)
Length: 967
>GLEAN_6324 class=GenePrediction position=GCSC_144:819303..818122 (- strand)
ATGGTCTTGGGGGGACTGCAGGGCACGGCTTCAGCCAACGCCCTGTCGACAAAGTACTTTCTGGCCGTCGATGGCGGCGG
CTCGTCCTGTACCGTCGTTCTGCTGAGCTCGGCCGGGGTCGTCTCGGTCGGCGAGGCTGGGCCATGCAACGTGTGCGTTT
CCGGGAAAAATCGAGGTGTCCACCCGTCTCGCGTTCTGCCCTTCTGACCTTGCAGCACGACCATGGGCATGGAAGCTGCT
CTGGCGGTCATCTCCGCAGCCATTCGGTCTGCCGTCTCAACACACCCAGACGTCGTCGCCGGCCACGTCCAGGACGTGCC
CATCGCGTCCGCATGGGTCGGCATGGCAGGCTACGATCGCCCACACCTTGCTGCAGTCCTGGACGCGGCCGTGTCCGAGC
TGCTCGGCATCCCGGCCGGAAACCTCCGTCTGACCGTCTCCTCCGACATTGATCTGTTGTCCGTCAAGGCGGCGTCCGAG
CGCTCGGCTCAGACTGCCGTCGTCCTCGTGGCCGGAACCGGATCCGTGGCCATGAGCTTCCAGCGCAGCGGTGACCGGTT
CACGCGAACGGCCAGGGCTGGCGGCTGGGGTTCGCTGCTCGGCGACGACGGATCCGGCTTCGCCATTGGCAAGGCTGCTC
TGCGACTTGCCCTGCGGACCAGCGACACGCTCCGGAATAGGGCAGCAAAGGCGGAAGCCGACGGCATGGACAGCCTGCCC
AGCATACCACCGCTCAGCGCGGCCGTCTACAGTCATTTCGAAGCCGCGCAAGAAGGTTTCGATCGCCGTGATCTGCTGTC
CGGCATCCTTGCCCCCCCGGCGACCACCGCATCCTCTGACAGCACGACTGCACCCCAGCGCATCGCTCGCGCTGCTCAGG
TGGTCCTCGCACTCGCCGAGTCTGACGACGAGGCAAGGGCCATCCTCCAGGAAGCAGCCGCAAGCCTGGCCGATATGGTG
ACGGATCTGGTCAGGGACCAGGGCGCTGACCCGGCCAATATCGCTCTCATCACGGCAGGCGGCGTCCTGAAGAACAGGCT
CTACAACAGCATGGTGCAGCAGGAATTGTCAAGAAGAGGGTCGGACTTCAAGTGGACCATGAATGTACAAGTCCCGGCCT
TGGAAGGGGCTCGCTGGCTCGCTGCCAACTATCGAGAACAGCACAGAGAGAATATACATTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62