GenePrediction:GLEAN_633 Details

Name: GLEAN_633
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1106224..1107033 (+ strand)
Length: 810
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1106224..1107033 (+ strand)
Length: 810
>GLEAN_633 class=GenePrediction position=GCSC_97:1106224..1107033 (+ strand)
ATGGCTGTATCCGCGCCGAAGAAGATGGTCACGGCCTCGTCGTCGGGGCCTGTCAAGCAGAAGGAGATTCCCGGCACCGG
AGCCGTGCCGGTCTCCCAGGTCAAGGGGCTCTACCTGACGGCCTACAACTTCATCTCGGCCATCCTGTGGACGACAGTGC
TGGGCCGCACGGCCATTGTGGCGGGTCTCCGCGGGCCGGCCTTTGTGCCGATTGTGGTGGACGACTTTCTGCGCTGCACG
CAGACCATTGCTCTGCTGGAGGTGGTGCACTCGGTGCTGGGTATGGGCGCTCCTGCAACGATGATGCCGATCTCAATGAC
AATCGCTGACAGCCTCGCAGGCATAGTTCGCGCGCCCCTGTTTACGACGGCCATGCAGGTGGCCAGCCGGCTGCTGCTCG
TGTGGGCCATTGTGTACCCGTTTCCGGCCGAGACGACGTCGAGTCCGTTCTATACGTCCATGGTGCTGGCCTGGAGCCTG
ACAGAGGTGATCCGCTACTCGTACTTTGCCCTCAGTCTCGCGCGCGGGCCCGAACGGCCGCCGCCGTCCTGGTTCACGGC
CCTGCGCTACAGCACGTTCCTGGTGCTGTATCCGGTCGGCATCAGCTCCGAGGTGCGGCTCGTCTACCTGGCTGCCACCA
CGCCCAGCGCGGCCGCCACTCTGCACCCGCTGTACCCGGCCGCGCTCTACGCCGTGCTGGCCGTGTATGTGCCTGGGTCC
TACATCCTGTACACGCACATGCTGGCCCAGCGGCGCAAGGTTCTGCGTCGGCTCAAGGCAGAGGCTGCTGTGGGCAAGAA
GGTTCAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62