GenePrediction:GLEAN_6340 Details

Name: GLEAN_6340
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:731057..729084 (- strand)
Length: 1974
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:731057..730867 (- strand)
Length: 191
Type: CDS
Source: GLEAN
Position: GCSC_144:730811..730224 (- strand)
Length: 588
Type: CDS
Source: GLEAN
Position: GCSC_144:730134..729241 (- strand)
Length: 894
Type: CDS
Source: GLEAN
Position: GCSC_144:729186..729084 (- strand)
Length: 103
>GLEAN_6340 class=GenePrediction position=GCSC_144:731057..729084 (- strand)
ATGCATCTCCCAAGAGAGCTTGCCATCGTCGGCGCTGTTGCCAGCTGGTTTCTGGCAACGGTCGCAACCGACGTGCAGGA
ACAGGCCTTCCGCCGTGCTTTGCAAGAGATTTCCACATCCAAGAGAGACACCGTGTTCCGGAACTCGACGTCGATCAGCA
AGAGCTTTGACGGAGCGACACTGTTTGATGCGTGAGTCCCCCCTCGAGAGCGAAAAGCGAGAAAGACAAAGCACTAACAC
CAGCAGGGCCATTGACGTGGGCACCAACACAGTCAACGCCGAAGTGGACGTCTCGGTGGTGTGCACGACCTGCTACGTCC
GCGGGTCGGCAACAGCCGAGCTGCTCGTGGACGGGACGTTCAACGCGACGGAGGCAATCCTGTCGGTGGCGCAGTCGGTG
CGCGACGACGTGGTCAACCTGACACTGCAGATCGAGAATGACGTGAAGGCGACGCTGGTCAATGACACGGCGCACGTTGC
GAACTTGCAATTTGACGAGGTGCAGATGCCGATGATCGACGTCGACTTGAATCTCGACGTCGAAGGCATCCCCGAGTGCC
AGCTCGCCTTCTCATTCGACCATCTCGAGCTGTTTGTGCAGACACAGACGCGAGTTGGTGGTGCGGCCACGTACTCGCTC
AACCTCTACACGTCCGAGACGGAGGTAGGGATCCGTGTCAGCGACGAACTCGAAATTGGCGTCGTCCTGACCGTCGACCT
GATCATGAGTATCGACGGTGCCGTCGAAGTCGACAGCGGCTTCCACGTCAAGCTAGACGACGGCCTGGTCCTGACGCTCG
ACTTTTTTGGCAAAAATGTGTCCAAGATGGAGTTGTAAGTTTTGGCTGTTCCTTTCTCGTTCTCGTTTCTTGCCTTCTTT
CTCTCTCCTCTCCTCTCCCCCACTCTCTCCTAACATATAACAGCAATGGCGGCTCCTTCGAGTTCCTCCCCATCAGCACC
AACGCCGAGGCCACCATCAATGCCGTCCTTCGCGTCGGCGTCCACGCAGGCCTTTTTCTTGACATCGATCCCATCAAAAG
CCTCGATCTCTTCCACTTTGCCGCCGGCGTCGACTCTGTCCTCTTTGCCGACGTCGCCAACATCACCACCAGCATCGCCG
CCAGTAGCAACCATTCAGCCGCCGACGACCTCGGCGTTGATCTCGTTGACTGCGTCCTGACCGCCGAGGAGATCTACGAG
TTTGCCATTGGCGCCGGCGCCGGTGCCTCTCTAGTCATCGCTGACAACTCCTGGGGCATCGGTCCAACCACCGTGCTGCC
CGTGTGGTACACCACTGTCGCCCAGTGTGCCACCAGCACGTCCAACGGAACAGCCCTTACCTCAGCCTCAGCCACGGCTA
CGCCTGCTCCCGCTGTTCGTCGTGCCGATGATTCCTCCGTCACCTCCACCATCAGAACCACCTTTACCTTCTCCGCTGTC
GGCTGCCGCTCGGCTGGCATCATCAATTGCCCGGCATCGCTGCAGACGACCACTGTGACGAAATCTGAGAGCACCATGGT
TACGGTCGTGTCCTCGGGTGCCGAAGCCTCCTGGCCCCCGCTGACTGCCACCACCGTCAAGGCTGTCTCCTTCGGCCATG
GCGCCAAGTCCATCCAGCTCTCCGCCTCCGGCACGCCGTCGTCCTTCGTGCCCACCACCACCGCCAAAGCCACAGCCACC
GGTTCGTCCGGCAGCGACGGCGACACCCTTTCAAACGACCACCACGGCGGCCTAACGACAACGCAGAAGAATATCGTCAT
TGGTGTCACCGTCGGCGTGGGCGTGCCGCTGCTGGCAGGCATCTTGGTGGGGATCATGTATGTGACTTTTTACATTGCTT
ATTCAGCAAAGCACTTGCTAACAGGACACAGCATCTTGACCAAGCACAAGAAAAGGCAACAACAGTTGGGCCAACCGAAC
AGCTCGTCCAAGGTGCCTTCAGAACAGGTGGTGGAGGTCGGCAGCAGGGACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62