GenePrediction:GLEAN_6342 Details

Name: GLEAN_6342
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:724748..723341 (- strand)
Length: 1408
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:724748..724407 (- strand)
Length: 342
Type: CDS
Source: GLEAN
Position: GCSC_144:724357..723341 (- strand)
Length: 1017
>GLEAN_6342 class=GenePrediction position=GCSC_144:724748..723341 (- strand)
ATGTCTAGCATTGTGCTTTCCAAGACGGCCGTGCTGCTGTCCTCGATTTTTGTTCTGCTTGCCTACTTTGTCGGACAACC
AGCCAGCCATACACTGACGGCGCTGGGCTTCTGGCGCCAGCCATCGCGCTCGCTGCTGGCCGACGACCAGACAGACCTGA
TCGTGATCGCCGACACGGTCAACTGCGAGGACCTGCACTACCATGCGGCCAGCCAATCGCTCTTCACGGCCTGCGAGGAC
ACGGTCGAGACGCGCTTCAGCTGGTTTCCACCGCTGGCCATCTTTGACGACCCGAGCGTGCTCGAGACGACTCGAGGCTC
TCTGCATGTCATTGATCCGGAGGTGGGTGAAAGTCCTCTCTTCTCCTCTTCCACTCTCTCACACGCACCAGACAGCCACG
TCCAGACGTCTGGCCATGCATGGCTTCACCGGTCCCTTCTGCACGCATGGCATCGACATCCTTGACGATCCGGACCGCCC
TGACGGCGAGGCCGTCTACATCTACGCGATCAACCACCTTCCCAACCCCGACTTCCCTTGGAATGGCACGCCAGCCGAGA
AGGATGCAGCCTCGGCGGCAGTTCCCAAGGCGCGCTCGCGCATCGAAGTCTTCCACCACGTCATCGGCTCGTCGACAGCC
ACGCATCTCCGGTCCGTCCAGCACCCGCTGATCCGCACACCCAACGACATCTTTGCCGCCAGCCCGCGCTCGTTTTACGT
CACCAACGACCACTACTACTGCGACGGCCTCTTGCGCGCGGTAGAAACCGTCGTGGCTGCGGCCCGGTGGTCCGACATTG
TGCGCGTGGACATGGACGAGTCTGCGGACGCGGCAGTCGACCCGACTCAAGGCATCACGGTATCTGCAGCGCTCGAAAGG
CTGCACAATCCCAATGGCCTTGGCCACGGGCGCACGCCAGACGAGGTGCTGGTCAGCGACTGCAGCAGCGGCGTGCTCAA
CGTCTTTCGACTGTCACCTCCTCCGTCCAAGCTGCCCCTCGAGCTCGAAAGCTCTGTCCGTGCAGACTCGGTCATCGACA
ATCCCAGCTATTTTGCTGACCCTTATTCTTCCGCTGGCTCTGCCGGCTTGCCGCCCGACGATCGCAGCGGCTATGTCCTG
CCTGGCATCTCTCACGGGTTCAACCTCACCCATACCAGCCACGATCCAGCCGCCAGCGAGGGCGTCATTGTCATGTTCGC
CCACCACGCGTCTCTGTCGTTGGACAACTCTGAGGCCATCGAGGCCCCGCGGCTGCTGTTCCAGGATGATGGCAGCCGCA
TCCGTTCAGCCAGCGCTGCCGTGCTGCTGGCCATCGATCCAAAACTCGAAGGTGGCCGGCGCAGGGCCTGGCTGTTCGTC
ACAGGGTTTCAGTCGGTGAGCGCCATTGCCGTCAAGGTGGACTTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62