GenePrediction:GLEAN_6343 Details

Name: GLEAN_6343
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:716983..714537 (- strand)
Length: 2447
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:716983..716723 (- strand)
Length: 261
Type: CDS
Source: GLEAN
Position: GCSC_144:716667..715029 (- strand)
Length: 1639
Type: CDS
Source: GLEAN
Position: GCSC_144:714973..714537 (- strand)
Length: 437
>GLEAN_6343 class=GenePrediction position=GCSC_144:716983..714537 (- strand)
ATGGCGGCCACATCCACGCCGCAAGGCACGCTACGCCATCGTAACGTGCCCGGCAGCAGCAGCAAGAAAAAGGATGGCGC
CTCATCTGATACAGATGTCGACAGCATCCTCCAGGTCACTGCTGCAACTTCCAAGCCGGCCGGTTCGGGATGGGACTACA
AGCTGGCACTCGTCGTTATCACGGCCCTCGCCTTCTTGACTAGATTCTGGGGCATCAGCCACCCCGACGAAGTCGTCTTT
GACGAAGTCCACTTTGGAAAGGTGCGTCGTACTTTCAGCTCCGGTTCTGCTTTCGTTTCCTGCTGACATCTCCTAGTTTG
CCTCGTACTACCTGGAGCGAACATACTTCTTCGACGTGCACCCGCCGTTTGGCAAGCTCCTGTTTGCCTTTGTCGGCTGG
CTCGTCGGCTACGACGGACACTTCCACTTTGAGAACATTGGCGACTCGTACATTGCAAACAAGGTGCCGTACCTGGCGTT
CCGGTCGCTGCCGGCACTCCTGGGGGCGCTGACAGTGACGGTGACGTACATGATCATGTGGGAGTCGGGCTACAGCCTGC
CGGCGTGCATCCTCGCGGCTGGACTGGTGCTGTTGGACAATGCACACATTGGGCAGACGCGGTTGATCCTGTTGGACGCC
ACGCTGGTGTTTGCCATGGCGTGCAGCATCCTCTGCTACATCCGGTTCTACAAGCTGCGGCACGAGCCGTTCTCGCGCAA
GTGGTGGAAGTGGCTGATCCTGACGGGCTTTGCGCTGTCGGCGGACATGTCGACCAAGTACGTGGGGCTCTTCGCGTTCG
TGTCGATCGGGTCGGCGGTGGTGATCGACCTATGGGACCTGCTGGACATCCGGCGGGCCGGAGGCGCACTGACGCTGCCG
GACTTCTCGAAGCACTTTTTGGCGCGGGCGTTTGGACTCATCCTGATGCCCTTCCTCTTCTACCTATTCTGGTTCCAGGT
GCACTTTGCGGTGCTGACGCGGTCGGGCCCCGGCGATGAGTTCATGTCGCCGGAGTTCCAGGAGACGCTGAGCGACAACG
TGATGCTTGCGAACGCGGTGACGATCCAGTACGGCGACACGATCAATCTGATGCACAAGGAGACGAAGGCGTATCTGCAC
AGCCACCCGGAGAACTACCCGCTCCGGTACGACGACGGCCGGGTGTCGAGCCAGGGTCAGCAGGTGACGGGCTACCCGTA
CAACGACACGAACAACCTGTGGCAGATCCTGCCGGGAGACGGCAGCAGCCTGGACCCGGGGCGGACGGTGCTGAACCACG
AACTGGTGCGGCTGCGGCACCTGGGCACGGACATGATCCTGCTGTCGCACGACGTGGCGTCGCCGTACTACCCGACCAAC
CAGGAGTTCACGGCGGTGCCGCCGGCCGATGCGTATGGTGAGCGGGCGGCCGACACGCTGTTTGAGATTCGGGTCGAGAG
CGGCAAGCCGGGACAGGAGTTCAAGAGCGTGTCAAGCCACTTCAAGCTGATCCACAACCCGAGCAAGGTGGCGATGTGGA
CGCACACGACGCCGCTGCCCGAATGGGGCCACAAGCAGCAAGAGATCAACGGCAACAAGCAGCTGGCACAGAGCTCCAAC
GTGTGGCTGGTCGAGGACATTGTATCGTTGGCGGCCGACGACGTGCGGCGGGCACGGCCAGAGAAGCTGGTCAAGACGCT
GCCATTCCTGCAGAAGTGGTTTGAGCTGCAGCGGTCCATGTTCTGGCACAACAACCAGCTGACGAGCAGCCATCCGTACT
CGTCGCTGCCGTACCAGTGGCCGTTCTTGCTGCGCGGCGTCAGCTTCTGGACCCAGAACGACACGCGCGAGCAGATCTAC
TTTCTCGGCAACCCGCTCGGCTGGTGGATCGCGAGCAGCCTTCTGGCTGTGTACGCCGGCATCATCGCGGCCGACCAGTT
CTCGCTGCGACGCGGCATGGACGCGTTGGATCACCGTGAGTACTAGTGTCTTGGATAGCCTGACAACTTGGACAAAAACT
AACCGGATAGGCACACGCTCGCGGCTGTACAACTCGACCGGTTTCTTCTTCCTCGTCTGGGCGATGCACTACTTCCCCTT
CTTCGTCATGGGCCGACAGCTGTTCCTGCACCACTACCTGCCGGCACACCTGGCGTCGACGCTGGTGGCGGGCGCGCTGA
TCGAGTTCATATTCACCAACGACGCGCCTGAGCCAGAGCAACCGACGTGCCAGCAGGTCAAGTCAGGCAAGAAGGCGGCG
CCAGAGCCGAAGCGACACATCTCTGCGCGTGAGCGGCTGGCCGGCCAGAGCCTTCTGGGCGCGTGGATCGCGACGGCTGT
CATTCTGGCCATTGTGGCGGTGGCCTGGTGGTTCTTCCTGCCTCTAACGTACGGCTACCCCGGCCTGTCGATCGAGCAGG
TCATGCGGCGCAAGTGGCTGGGCTATGATCTGCACTTTGCCAAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62