GenePrediction:GLEAN_6344 Details

Name: GLEAN_6344
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:712565..710978 (- strand)
Length: 1588
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:712565..712502 (- strand)
Length: 64
Type: CDS
Source: GLEAN
Position: GCSC_144:712385..711449 (- strand)
Length: 937
Type: CDS
Source: GLEAN
Position: GCSC_144:711086..710978 (- strand)
Length: 109
>GLEAN_6344 class=GenePrediction position=GCSC_144:712565..710978 (- strand)
ATGGGCAAAGCCACCATGGACAAGGATGTTCTGTTCAGCCTGTTCGCCATGTTCATCATGTTCAGTATTTCTTTGTTCAT
TCCCCAGCGCCTTTCACCCTCACGTCCTCGGGGCCTCGAGTCTCGAATACATAATCTCGTCGTCTGCCGTTCCGGCTCAC
CGTCTCGTCGCCATGACCAGACCCGACCGAAGAAGCAAACGGACAAGTGATTTGCCCCGAACACATCGACATGTGCCACA
TCCGACTGTCACTCTACAACGGCTGCTACCACAACGAGCGCATCCTGACGCTCTGCGACAAGCAGCAGCAGAAGCGGCTC
CAGAAGTACCGCGAGCACCAGCGCCGCGCACAGAAGAGCCGCGGCTTCTTCGCCCGCCTCTTCTCGTCGTCGCCTCCGCG
TCCGCTGCTCCAGCCGGCCACCACCTTCTCTTACACCAGCTTCGACATCCCCAAAGACGTCCTCCGCCACAGCTGTCGCC
CCAGCATGATTTCCGTCCAGTCCACCAAATATCCCGACGCCTGTCCGGACTGCCAGTCCTCCTTCACCTCGTCCAAGCCA
GCGACCTCGTCCAGGCCGACGACCTCGAACAACAGGCCAACCACCTCAGGGTCCAAGCCGGCCAGACTCCCCTCTCCTCC
TCGCACTGCTGGCTCGTTTCCCGGCTCGTCTTTGCCCAATGGCCGTCCTCCTACCCGCAGAGGTGTCTTGCCCTCGGCTC
CGGCTGGCCGTCCTGTTCGTCCTGCTCCATCTCCTGCTCCTCCTCGGCTGCCACCTCAGCAGCGGCTTCCGTCTCAGCGC
TGGCCTCAACGGCAGCTGCAGCCCGCCATGACCTCGTCGCAGAGTAGACGTCCGGCCATGCATCCCAGAAGCAGAGACTC
CATCGTCGATACCGCCATCGCCCTGCCGCCTTCTTACCCCGTTGGTCCGACTGGGTCGGTATGCTATCCCGCCCCAGTGC
GTGCCAGCGTCACCCCCGGCGCTGCTGCCCGTGGGAGCGTGGACCGTTATGTCAGCCCCCTGGACCAGAGCCGCTACGAG
CGCATGGTGTCTTCGTCGACGCGTCGGGTGAACTATCGCCTGGACGTCCGCAGACAGCAGCCATATCAGACACCAAGGTA
AGCCAGCAAGAGCACTCTTGGTGAAGGGACATACGTGTCCATGTCTATTTCATTGGGATACATATTCACTCTTTTGTCTT
TCTCGGTTATATCCTATTTGTTTCAGCACAGACAGTAGCGAATCCATTGAATTAATTGAAGTCTTACGGAGTACCATCTC
CACGTGACTCCCTCGTATATGCGCGTGCACTTGCCAGAGGTCGATCTGTCCGAAATTCCGTCAGCTCGACCACACCGCAG
AAGAGGAGAACAGCCGGTCCAGGCACCCTCCACTCCATCTCCTCAGGCTGCACGATTCTCCCCGGTCCTACTGGACAGTA
ACAGCCTACTGAGATCCGGGCATAGCGTCTGCGCAATAGGGCTGATGACCATTCTCTGTCCAAGATAAGAAGACACTGCA
ATGCGTCGGATGGCTACGTGGCCTTCTTTCTGCTGCTCCGTTCGACTCTCAACCCGGATCGCCAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62