GenePrediction:GLEAN_6345 Details

Name: GLEAN_6345
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:708879..706459 (- strand)
Length: 2421
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:708879..708199 (- strand)
Length: 681
Type: CDS
Source: GLEAN
Position: GCSC_144:708075..707906 (- strand)
Length: 170
Type: CDS
Source: GLEAN
Position: GCSC_144:707845..706459 (- strand)
Length: 1387
>GLEAN_6345 class=GenePrediction position=GCSC_144:708879..706459 (- strand)
ATGGTCCTTCACAAGGGTGCAACTTTCCACTCTCCAAGCAGCCCGGCCTCGCAGTCTTCCACCTTCGGCCCTCCATCGCT
GCCCCGTGCTCAGTCCGACCTCGACGACGTCCTGGACGCCCATCGCCGCCGTGTCGCCCTGGAACTCGACTCCATCGACA
AGACTCTGGCATCCATCCACATCTCTACCAAGACCACCAAGAACAAGGCCGCCCTGTCGTCCTCTAACGTCGCTCTGAAC
AGCACTTTCTACATCCCCAAGGCCGTTCTCGACCACGCACTCTCGTCCAAAGCACACTCTGTCGACCAGCGTTGGGTTCT
GCAACCCCGCTCCGTCAACCGTCGCCCCTCCAATCATCACCACGGCTCCGACAGCGGGCTCGGCTCTTCCGTTGCCTCAA
CCAGCAACAAAACCGCCGGAAAGTCTGCCAAGCGGACGTCGTCTGTCCAGGCCGCCGCCGTCACTCGCTCTGTCGCTTCT
GTCTCGTCCACCACCGAGTTTCAGACAAGTCTGAGTCCTCGTGCCACCAACCGCATTTACGAGCACACCGTGAAGCCACT
TCTGGCCAAGCCGGCCTATAAAGTCTTCCACCCACTCCTCCTTGAGTGCACCACCAAGATCAACAAGAGGGACATCGTCT
GCCTTCGGGACGTTGAGAAGACCGTTCTGCTTCTTGCACCGGTAAGTCAACTGTCTTCTGATTCGGGGTTGCGGGGAAAT
ACTTATCGTGCCTTGGTAAAGGAACGGACCAAAGTCGCCGAACTCTACCTTCGATTTTGTCTAGAGTCTGTCCGCTGTCT
CCAGGCGACTGTCGAGTACCTGAGTGACCGCGAGCAAACTCGTCCGTCTGACCCGCCCTACACTTCCGGCTACTTTATCG
ACCTCGTCGACCAGATTCGCCATTACGCCCGACAACTCGCTGACGCAAAGGAAAAGGAGGCATCTGGAACAGCAGACTCC
ATGGAGCTCAATAGGTACGGCGCACTGTCTGCTTCAAACATTTTGCACTCGCGTCCTAACATGTCCCTTTGCAGTTCTGA
CCCGATCAAACTCCACGGCGGCTTCGCCGTGAACGGCCGTCCAATGGAGCTGGTCCGCATAAGCCGGGACGGCCGTGCCG
TCTCCATCGCGACCGGTCTTCCTGTCGAGCTTGAGGAGGACATCAAGGACAACATCCGCATCAAGCGGTCTGCCAGCCAG
GAACTCGAAGACGAGGAGGAGATCATGCGTTCCATGGCACGCCGGAAGAAGAACGCCCCCCCGGAGGAATACGCCCCGAA
GACGTGCAGCGTCGACGGCTGCAAGAAAATGTTCAAGCGCCCGTGCGACTTGACTAAGCACGAGAAGACGCACTCGCGTC
CGTGGAAGTGCCCCATCCCTTCTTGCAAGTACCACGACTACGGCTGGCCGACGGAGAAGGAAAAGGACCGTCATCTGAAC
GACAAGCACTCGGACAACCCACCAATGTACGAGTGCCTGTTCAAGCCTTGCACGTACAAGTCCAAACGTGACTCCAACCG
CAAGCAACACATGGAGAAGACGCACGGCTGGACATATGTCCGCACCAAGACAAACGGCTCGGGCATGAGCGTCAGCGGCA
AGCCCGGGAAGACAGGCCTAATCACCGATGAGGAGGGCCGTGCCAGCCACGATTCCGACAGCATGGCAAATACAACGCCG
CCCCTGGTCAATATGCCCACGCCTGTCAGCGCACAGAGCCCGGCTGTGGCCACGCCGCCCTTGGACGAGTTTGCTGCTCC
TCTGTATTCCCACAATATGGCCAGCTATGAGTTTCCCACCTGCACACTGAGCGATGTGCTCGCCACAGAAATGGACCTGC
CTGCTGAGATTGACGATCTCGACTTCTCTCCCATCGACAACAACTCGCCTTCCACCATCTCTAGCCTCGACAACAACTCT
GCGTACCAGGACCTCGGACAGGATGCAATGATGTTTGACGACATCTACAGCGCCACAGTACAGCTCCCCACCCCGGAGCT
AAACCTCTACAGCAACGATAAGAACATGCTCGACCGGTTTATGGCACTGTCGGGCCCCGATCTGTGTGCCCCGTTGGTCA
CGCCGGAGCAGCAGCAGCAGCTTATGCATCTGCAGCATATGCACCAGCAGAGACAGCAGTTTGAGCAACAGTTGCAGAAG
GAGCAGTATCTGCCACACATCTCGCCACTTGGTGAGGGCAACACTATGCTCTACACGCCAGACTCGCAGATCGAATACGA
TGAGGGCTTTGTCGACTTCCCAAATGATCAGATGACCAAGGGCGACTTCATCCTATTTCCGCCTGCGGCTTTGAACATGC
GGCCGACGACGACGGCGAGCAACAACCTGTTTGACGACCTGACTCCAAGTCTAGCAGCCGGTTATTCGCAGCCGAATTCC
CAGATCTTTATGGACTGGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62