GenePrediction:GLEAN_6346 Details

Name: GLEAN_6346
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:699764..697508 (- strand)
Length: 2257
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:699764..699318 (- strand)
Length: 447
Type: CDS
Source: GLEAN
Position: GCSC_144:699061..697610 (- strand)
Length: 1452
Type: CDS
Source: GLEAN
Position: GCSC_144:697546..697508 (- strand)
Length: 39
>GLEAN_6346 class=GenePrediction position=GCSC_144:699764..697508 (- strand)
ATGGCTCCGCCTACCAACACTCGCGGTGGCTCAAATGCGCGCACCCCAAGAGGCTCTGGGCGGGGAGGCGGACCTCGGAA
TAGGGGCAGTGGCGCCAAGGTTGATCGCAACGGTGACGTGATCATGGGCAACAGTCCCGTCGCAAAGGGAGATGGAATAA
GGAAGAGCAGCAACTCATCACGAGGCCGTGGTGGATCGCGCTCAAACGCTACAGCAGAGCAAAAGATTCGAAGGCATCTG
GGCGTTACCGACGGCGGCAGTCTGGCAAAGCGAGTGTCGGAGCTTCCGCGCAAGAAGTTCAGCAGTCATGCAAATCGCAA
AGTTTTCAGGATTGTGGGCTTGGAGCAGAGTAAGGCAGCCTCAAATGCCGATCGAGGAGAAAAAGGAATGCTTGAGTTTT
TGGAACGGAAGTCGTCGAATATGGGTCGCGGTGTCAAGATCATCAAGGTATGTATTAGATGAGGAGATCGGTTTGGGAAG
CTCACGGCGTTTTCGACAGTGGCCCCCTCTTTCCCGTTGTCTTTTCCTGCTTAGCAGTTATTCGGTTGAGGTCAGAGCCG
GCGCGATGCGAAACTTGGACAGCCCTGTTATTGCTTTTGGCCACCAAGACTGCTCGAGGACCTCACGGGCTCCCAACCCA
TCACCACTTCTTCACCCGTCTTGGGTGATTTATTTCCCCGCCTAGCTAACGGCAAAACAACAGTCACGGCTCGACAGTGA
CTTTGTTCTTCATGTCATGGTGTCTCAGGAAGATGCTGAAGAGCTTGCGAAGCTGAACGGTTTCTCATTCGCCGGCGCAA
AGCTTATCGTCTCCGAGGACCCACAAGGATGGCCTTCGCAGACGGACGCCAAGCCCAAACTATCCCAAGAGTCGTTGGAG
CGAAAGAGCCAGCTGCAGCAGGTTCTGAGCAACCGGTACGACCCTACGACCAAGCTGCTCAACCTATCTGCCCTGGGCGA
GGATCCCGTTCTTATCGGCATGGGCTACTTGAGCGAGAAAGATCGTGCGGAAAAGACCTTTAAGGTTCTCATGGCAATTT
GTGATGAGACATTTCCCACAGCAGAAGCAAAGCGAGAGGCAGTTCTCAGCGTGTCACTGGCCAACAACAATATCGATTAT
GTCGGACAAGTCTTTGACTTGGCCGAAACATTTCCGGAACTAAAACATCTGGACTTGAGCGGCAACCAATTTAAATTCTT
GAAAAGTCTCAATAGGTGGAGAGGACGTTTTCGCAACTTGGAGACACTCCTCATGACAGGGAACCCTGTTGAGAAGGAAG
ACCCGAACATGGTAGCAGAGCTCCTACAGTGGTTCCCAAAGCTCATGAACCTGAGCGGCATTCAGGTCCGAACCCCGGAG
CAGATCGCTGCTGCCGAAGCTGCAAAGGCTGCAGAAAGACCTACGCCAATTCCGCAATTCGGCCCAGACTTCCGTGACAG
CAGTGGGATCGGCGAAGCATTTCTGACACAGTTTCTTCAACTCTACGACACCGACAGAGCACAGCTTGTGAACACCTTTT
ATGACAGCTCCAGCCAGTTCTCTCTTTCTGTCACCACAGCTTCACCACGAGATCACGGTGACACCCCAGTGCTTCCATGG
GCCGCGTACCTACGGTATTCTCGGAACCTCACCAAAATCACAACGAGAAGTGCACGCATACAGCGGCTGGTCAAGGGTGC
TGCCGTGATCAGGGAACTCTGGAACACACTACCACAAACAAAACACCCAGATCTGAAAACGGGGCTACAAAAATACATTG
TCGACTGTCATCCGCTTCCCGGTATTTCGGATCCCTCTGGCCAGAGTCCGGTTGGCGTGGATGGTCTCCTGATTTCTGTG
CACGGCGAATTCGACGAGCTCGACTCAGCCACCGGGAAGTCTGGCAAGCGTAGCTTCACACGCACATTTGTCCTTGGTCC
GGCTTTGCCTGGCGCTGCGACTGCGTTCCGCGTTGTCAACGACATGCTGTCCTTGAGAGCACATCAAGACATTCCCGAAC
AAACCACCAACACGGTATCGGAACAAGGCCAGAAGCAAGAACTCATAGCCGAGCTCTCTAAAGTCACCAACATGAATCCG
CAGTACTCAGAGATGTGTTTGGCGGAGGCTGGGTGGAATTTCAGTGCGGCTATTGCAAAGTTCAATGAAAGTCAGGTATG
TAACTTGCAAATACTCCCTCAGGAAGTTAAGAATGTGAGCTAACTTTTGCTGCACCAGCCAAACCTTGGCCCTGAAGTCT
TCATGGCTCCTATGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62