GenePrediction:GLEAN_6347 Details

Name: GLEAN_6347
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:693624..688609 (- strand)
Length: 5016
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:693624..691291 (- strand)
Length: 2334
Type: CDS
Source: GLEAN
Position: GCSC_144:690527..689416 (- strand)
Length: 1112
Type: CDS
Source: GLEAN
Position: GCSC_144:689146..688609 (- strand)
Length: 538
>GLEAN_6347 class=GenePrediction position=GCSC_144:693624..688609 (- strand)
ATGGCGCTTCCTCAGCCGACCGTCGCCTTGACGGACGTCTGTGCCGTCATGTTCAACAACACATTATACACATACTCGGC
CGATGCCTTCCAGTCTTTGGCCTTTACAGAGGGCGCCGACTGGAAGAAGCTCCCATCGGGTGAGTCTGTAACCGGAGGTG
TCTGTCTCGGCACGACGCCAGCAGATGCGGCACAGGCAGGTTTCTACGTGATTGGCGGATCGAGCAGCACCAGCAACTAC
ACCGGGCTGCAGAAGTTTACATATGCAACCGGCAAATGGGAGGCAATCACGCCCGGATCCCTGGTCACACAGGACCGACT
ATATCACGCAGCGGTCTACATCAGCGATTCAGACACGATTCTCATGTACGCTGGATCTCAGGATGGCCTGACAGGAGATT
CGACCCAGACTTTTACCATTGGGGCTTCTGCCCCTTACAGTGTGCTCGCATACGAATCTATCGCGCCGCCGACAAAAAAC
CCGATCCTTCTCCAATGGTCGTCGTCCGAGGCTGTCCTGATAGGCGGCAGCACGTCGAACAACCAGGTGATGCTGTTCAA
CCCGACAAGCGGCGGATGGAAAAACTCGGGAGCCACGCTCGCAACGGCGCTGTCAAAGGACACCTCGTGCATCCAGGCAG
CGATCGTGACTGGCGACGACAGCAGCAAGAACCTCTACACCCTTGACATGAGCGTGTCGCCCAACGAGGTCAGCCGTATG
GTTCTGATGGACGCCAGCGGCCAGCCGGTGACGAGCTCTGCCCCCGTCAAGCGGGCGCTTCCAGGCGATTATTCGGCGGC
CGGGCAGCAATGGAACGACATGAGAGCACGGGCAGACACCCAGTCTCTCACGCTTAACAGCTGGCCTACGTACAACTCAT
CGCTGGCGCCCACGGTCACCCGCACCGGGTTTTCCGTCGCAGAAGGCTCGAACGGCACGATTGTGGCAGCGGGAGGTGGC
GGTAGCGAAATACTCTGCGTGTTCAACGGCAGAGAAAATACGTGGCAGAACGCCACGCAGATTTTCAGCGTTGCGCAAAA
GAACCACGCCAAGGTGTCCCCGTCGGCATCGGCATCGGCATCGTCAACACCGACGACTTCGGAAGTGGCAGCGTCGTCGG
CAGCGACGTCTTCGGCAGCGGCGACCTCATCGGCGGCGGTTGTGGCCACATCACATGGCCCGTCGTCTGGAACAATTGCA
GGCGCCGTGGTAGGCTCAATTGCCGGGCTGGTCATCATTCTGCTCGTCGCCTTTTTCCTGATCTTGCGCCGGCGTAAGCA
GAAGAGCCCGAAGGACGCAGCTGCTCACAACCGCCAAATCAGCGAGGGTGGGTCGTCAGAGAAGGATGCATATGACTTTA
TCAACGGGAACTCGATGCCGCGGCCGATCGGTGGCGGGGCTGTATTCCGGGGCAACCACCAGGCGCAGGACTCTCAAGGC
TCCTTCTCGTCCGTTGCAATTCTGATGGGCCGTGTCAACCAACCGCGGCCGGTGTTGACGATGCAGCGCAACAACGGCGG
AGACGCGAAGCGAGACTCGGCGGACAGCGTGTTCAAGGCATTCAAGAGCACGATCAGCAAGCCGATTCCGCGGACAGTGG
AAGAGCAGAGCGTGGGAGTCGTGGCAGTCCCACAGCAGGCGCAGTTTGAGCGAGCCGGCTCCAGTCCGTACGGCGGCAGC
GTGCCGCAGGCAAGACCAATAACGGAGCAGTCGCTGCAGCCGGACAACACACGTCGGTCTTCGGGCTGGAACCGGTACTG
GTCGGGGGGCAGTGCGCTAAACATTATTGGATTCGGAAGCGGAAATGGGAACGCAGCGGGCAGTGGAACAGGCAACGCGA
CCCTGCTGAACGCCGACTCGAACCGGACGACGGTTCTCAGCGACGCGAGCAGCCGGTACTCGGCGGGCGACCAGAGCCAG
ATGATTCAGGAGTCGGCCAGAGTAGCGCCGCTAGCGATACCCGTGATGCCGGAGGCTCGGCCTCATTTCCAGCGGGTCAA
CTCGGGCTCGCCGACGGTGGCAACGTTTAATAGCTTCCTGGCCAACGGGATGCAGGGCAAGATTGAGCGGTCGACCAGCC
AGTCGTCGTCGCGGTCGGGATACTCGAGCGGGATTCCGGGCAGCGTGCACGAGGCGTGGGACCCGACAGGCTACAATGAG
AAGCCATGGGGGACGGACAGGGCGCCAAGCAGCGCATATAGCACGCCTCTGACACCGTCAACCGGTCCTGGAAGCAAGAA
GTACGTTCCGACAGGGATGAGTCAGCAGCCACAGCTCGCCAGTGCCAACACGTCGTCGGACATGAGCTGGCTGAATCTGG
GAGATGTTTCCCGGGTATGATGGAGCCCAAACGAACGCGATGATGTTGACTCTCTTACACACACACACGCTCTCTCTCTC
TCACACATACACACACACACAGCCAGCTTTCTACATTCTTTCGCTCATCGGCTGGGCGCTCTATTTCTCATGTCAAGCGG
ATGTCAAACTCCGTGCCAGCAGATTTCTGTTTTATGTCTCTCGCTTATACCCAAGCATGTTCCCTGTCTTCTTAGCCATC
ACCTAGTAGCTCGCACGCCATCATAAGACCGCTGAAGGAAGCAGGGTCGGGAAGTTTCGCATACACTTGTATTTCTTTTT
GTATTTCTAGGATTTTGCCGCATAAAAGTAATAAGTTAAGCACACGGTGCTCCGGACCTTTCGGAACAAGCAAACGGCAG
ACAAAGGGGCACGCAAGCGGTCCACAACAGCGATAATTGCAGGTGTTTGTAGGGACTAGTGGGAGTTCCCGATATTTTGG
CAGGTGTTGTGTGGGCGGAAATGGCGCGCTCCTACCACTGTTGCTGCCCAACGTGGCAGGAGGTCGGGGAGCTTAGATCT
GCAGGTGCTCCGTGTGCGGGAAAGCCGGGAAAACATGCGACCCCCTATTTTTAACTTGAGGCCGGGGACAAACGACATAT
GCAGGGAGCAGTTGAGCAAATAGTACGACGACGTACGAAGTATTTATTGACTCTGGCGTGCTGGGCATCTGGCTCCGATT
GTTTTTACAGGTCCCACAGGTCTAACATTCTGCTTTCCATCTGACATTCGATTTCAGCCTATATCTGTCCTCATATCGAC
GATGCCTTCTTACTCGGCGTCTCCGATCGGGCTGCTGACGGCGGGCACGTCAAGCAGCGCGGCGCCGGCCGGCCAGCTGA
CGTTGGCGGTGCTAGGCTGTGGCGCGATGGGGATAGCGATCCTGTCGGGGATGCTGGCGTCGATCGCGGAGATGGACGCA
CCACGTCCGCTGCAGGTGGTGGCGTCGGGGCCGAGCAGCGGGCACAGCAGCGGGCACGGGGGCAGCAGTGCCTCAGGGAC
GTCGACGCCGGTGTCATCGGCCACGGATGAGGTACCAGAGCGACTGCCAGGACGATTTATCGCGTGCGTGCGGCGAACGG
AGTCGGCGAAGAAGGTCAAGGCAGCCCTGTGGGCGCACTCGTCGGCGGTGAAGGTGGTGCAGAACGACAACGTGCACGCG
GCCCAGCTGGCCGACGTGGTGCTGCTGGCGTGCAAGGCAGACGCGGTGCCGACACTGCTGGCCGAGCCAGGCATGGTGCT
GGCACTGCACGGCAAGCTGCTGATCAGCATCTGTGCGGGCGTGACGGTCGAGCAGATCGAGGCCGACCTGCACGGTGGCA
TGGTGCCGACGCTGGATCCGGCCGTCGATGGGCGCTGCCGCGTCGTGCGGGCGATGCCCAACGCGGCCGCGCTCGTGCGT
GAGAGCATGACCGTCATCGCCGCCTCGCAGCCGCCACTGCCCCCTTCCCAAGCTGCTCTGGTCACGTGGATTTTCCGTCG
CATCGGCGATGTGGCCTATCTGCCGCGCGAAGCCATGGACGCCAGCACCGCCCTCTGCGGCTCCGGACCGGCCTTCTTTT
CCCTCCTGCTCGAGGCTGCCATCGACGGTGCCGTCGCCATGGGCCTGCCGCGCGCTGAGGCCATCCGCATGGCCGCTCAG
TCGATGCGTGGCACCGCTAGCCTCGTCCTCCACGGCGACCATCCCGCCTTGCTGCGCGACCGCATCACAACCCCCGGCGG
CTGCACCATCGGTGGCCTCATGGTGCTCGAGGAGGGCGGCGTGCGCGGCACCGTGGCCCGCGCCGTTCGCGAATCCACCA
CCGTCGCCAGCCAGCTCGGAAAGGGCGTCGAGGGCGTCAATCGGACGCGGTTTTAAGGAGAGCAGGAAAGGGAGTTGTCT
GTCTTTGTCCACGTACTCTTTCTTCATCCTCTCATCCATACTCGATACTCTCTTCACTACCCTCCACATCTTTTCGGTCC
ATAGATCAATTGCATCCCATCTACACAATGTAGCATGTTTTCTCTATTCAGCTTCCGTCATACGCTGCTATTTACACGAG
ACAGCCCTGCATCAGCTCTACCAACGCCACTCTAGTTGCGGCCCTGTTGTCGTCAGCATCCCTCTAGACAGCTTACAGGC
ACGAAAACGGGACGTACCTCGAGAAAGCCCTGCATGAAACTGGACGGCAGCTTCTTCTCGCCCCGGATCGTCTCCTCCTT
GAAGAAGGCCATGACGTGCGGCGTCTGCCGCCAGAAGTTGCGCGTCTCCTGGTAGTCGGCCGAGCTCTGGAACAGGAGCA
CGTCCACCACCGGCAGCTTGTTGACAAACCGGTGTCGCTCAAACTCCTGTCGGATCCGTGTCCGCACTACTGCCACCGGC
AGCGGTACCTGATACATCGTCTGGATCTCCGGAGCCTGCGAGCGAGGTCAGCTTCCTGCCAATCCCACCTGGATGCCTCT
CCGGGACGTACAGCTCGGATCCATTCGCGGTATGCCGACAGCACTCTCCGCCTCGCCTCGGCCCAGCTCGTAGCTGTGAA
CAGGCCTCTCGTCAGCGCTCGTCCGGAACAGTCCGGCAGGAAGGGAAAGGAAGAGGGGAAAGGCAGAGACAGCCTGTTCC
GACGTACACTGCCGCGTCACGCGCGCAAATTCGGAAGGGGAGATGGCCATTGGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62