GenePrediction:GLEAN_6349 Details

Name: GLEAN_6349
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:685816..682041 (- strand)
Length: 3776
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:685816..685057 (- strand)
Length: 760
Type: CDS
Source: GLEAN
Position: GCSC_144:685003..682041 (- strand)
Length: 2963
>GLEAN_6349 class=GenePrediction position=GCSC_144:685816..682041 (- strand)
ATGGCGCCCCCGGCCCATCAACCAAACGGTAGCCAGGCCCCCCCGTCTCCACCTGTGCCCTGTGAGGACATGCAGCTGGG
CATATACGCGCCTCCGGCAGCCTTTCCCCTCTCTTTCGTCCACGTACCCCATTTATCCCAGTTTCCTGCCAGACAACTTC
ACGATCCCTCGAGCACTAACCAAGACTGCCCTCAAGGCCGACAAGACCTCCACTACGGCAGCAGCAGCACGCCGTCCAAC
GACCTGGCTTCCTGGAATGCCGCGGTGCTGCTCGATCCCAGGAGCCATGCCTTCCCCCCCGAGTCTCGGCCGCAGACGCC
CGACAGCATCCACTCGTCAGCCACCAACACCATGGCCGGGCTGGAGAGTGCTGCCGGCTCCGTGTCGGGTCTCTTTCTCG
GCGACGGCCACGGGGCTGCGCTCGACCCCGGATCGTCCCACTCGAGCGAAGTGACGTTCCGCTTCATGACGCCATCTGCC
GGCGGCGTTGGGACTGGGACGCCACCGACGTCTTTCCTTGGCGGCCCCGACTTTGGCGGCATGGCATCCCTGATCGAGCA
GGGCTACCATTTGAAAGACCGCAGCGACGTGCCGGAGCCAAAGCGTCGCAAGGTCGACCTGTTTAGCGGCGGCAGCAGCA
GCGGCATCCTGGCGGACAGCCTGCATTCAGATGACAGCAAGGAAGACGTCAAGGTATCGTCCGAGGCACTTGCACCGGCA
AAGAACCCGGTGACGGTCGACCTGACCGGTAGTGCTGACAGTAAGAGGATCTGCGCGGCGTGACCTTGTGCTGTGCTACC
GCTGACATGACAGACAACCCTGTCGGCACCGACGCCAAGGACGCGTACCACGAAGTGTGCTACGGCATGCTGACCGGAGT
CTCGGTGGACTGCCACAAGCTCCCGGTCCCGAAGCCCGGGATCCAAGCGATCGGGGGACCGGCCTACTGGCCGGCCGTCA
AGATCGTGCTGCGGCGAATCGACAACGACCGGACAAACACGATACAGGTGTACGACCACACGCGCGAGGTGTTTGGCAGC
CTGGACAAGCGGTCGGCCAATTGTTTGACGCCGCTGATGGACATCTCCAAGGTGCACCTTCGCACTGACGCGCGCATCCC
GTCCCGGCGAAAGAGCGAGGACGAAGAAGCGGGCCAGCCGATCTCCAAGTCTTATAGAATAGAGCTTGTCCTGTACGGGG
CGTCGACCTTTGCCAAGCCGGTGTGGAAGCGGGTGGCAGGCTTCGGCTTTGGGCTGGTGACGCCGCATCGCGTGCAGCCG
GGCATCCGGCTGATGCTCCCGCAGGAGCCGCTGGTGCTCTCGCCGAAGCCGAGTGACGGTCAGCTGTCGTCGTCGTCGTC
GTCGACGGCAGCCACACGCCCACCGCTCATCCTGCCGCCGACCTTCCAGACTAGGACGATGGAGGACATCCGGTCGGAGG
TGATGGCGGTGTTCGACTCTCTGGCCCACACGGATGACCTGCCAGAGATGGAACCGGACTCGTGCGTGCTGACGCCGCTG
CTACGGCACCAGAAACAGGGTCTCTACTTCATGACGACGCGCGAGACGCCACTGGCTCAACAGCATGGCAACAAGTATAT
GTCTTCGATCTGGACGAAGAAGCCGGATCGGTCGGGCTGTCCGATGTACCACAATGTGATCACGGACCAGCTGCTGTCCC
AGCCACCGCCCGAGTCGCTGGGCGGGATCCTGGCCGACATGATGGGACTGGGCAAGACGCTGAGCATCCTGTCGCTGATC
GCGACGTCTCGGCAAGCGGCAGAGCAGTGGAGCCGGCTGGCACCGGAGCAGCCGACAGAGGTGGTGCGGAAGAAGAAGGC
GGCCATGTCACGCAACTTTGAGCTGCCGGTGCCACAGGAGCTGGGCCTGACGCAACTCCGACGCAATGGACGCGGCACGC
TGCTGGTGTGTCCGCTCAGCACGATCACAAACTGGGAGGAGCAAGTGAAGCAGCACCTAGCAGCCGACGCGCTGAGCTTC
CACGTGTACCACGGACAGAATCGGATCAAGGATGTGGCGCAGCTGAGCGAGTTCGACCTGGTCATCACGACGTACGGCTC
GGTGTCAAGCGAGCTGACGGCGCGAAATCGCGGCAAAGCAGGACCGTTTCCGCTCGAGGAGATCGGCTGGTTCCGCATCG
TGTTGGACGAGGCACACATGATCCGTGAGCCGAGCACGCTGCAGTTCAAGGCCATCACACGGCTGCAGGCCAGCCGGCGC
TGGGCGGTGACGGGAACACCGGTGCAGAACCGGCTTGAGGACCTGGGCTCGCTGCTGTCCTTTCTACGGCTGCAGCCCTT
CCACGACCGAGCCAAATTTGCCCATCACATCGTCAACCGGTTCCGGGCATGCGACCCGGACGTGCTGCCGCAGTTGCGCA
TCCTCGTCGACACGATCACGCTGCGCCGGCTCAAGGACAAGATCGACCTGCCGCCACGCACCGACGTGACGATGCGGCTC
GACTTCGCGGCCGATGAGAAGGAGATTTATGATTTCTTTGAGCGCGATGCCAACGACCGGGTCAAGGCGCTGACCAGCCA
GAGCGAGCGGTTGCTGGGCGGTAAGACGTACATCCACATCCTGCAAGCGATCCTGCGACTGCGCCTGATCTGTGCCCACG
GAAAAGACCTGCTGGGCGACGACGACCTGCAGCGAATGCAGACGGTCCAGCGCGAGACAGAGCTGATGCTGACACTGGGC
ACGAGCCCGGAGTCGGCCATCAACCTGGACGACGACGAGGACGAGGAGAAGAACGGCCGGGTCAAGGGTCCGCCCTCCGA
ATCGAAGCTGTATGAGATTTACGACCTGCTGGTGAATTCCAACTCGGACAACTGTGTCATCTGCAAGCGCAAGCTCAGCT
CGCTCGAAGACATGTCGGCCAACATCCGGTCCGAGAAGCAGGAGGACGTGGTCGGCTACATGACGCCCTGCTACCATCTC
TACTGCCCGGACTGCATCACCCACTTCTGCGACGAGGAGCGTGGCGCCACCTGCAACAGCGGCCAGCCCGGTCGCTGTCC
CTACTGCCGCGATCCTGTCCTGTTTGCCTGTCCGGAAATCCGCCGAGACCGTGCCGACGGCGAGCACGACGCTCCAGGTC
ACAGCCGCGACCTGGACGAGGGCAGTGATCGTGCAGCGAGGCCGCCGCTCGTCCACGGATCACCTGCTGCCAGTCGGAAA
CCCGTCGATCTCAAGGCCTATTCGGGACCTCACACAAAGACGCGGGCTCTACTGGCAGACCTGCTGGACCACGAGCGCGA
GAGCGGGACGATGCCGGACGAGCAGCCCATCAAGTCCGTCGTCTTCTCCGGCTGGACCTCGCACCTCGACCTGATCGAGC
GGGCTCTCCGCGACAACGGCATCGCCTTCTGTCGCCTCGACGGCAAGATGTCGCGAACGGCCCGGACACAGGCCATGGAT
ACCTTCCGCGACGATCCATCTGTGCACGTGATCCTCGTCTCCATCATGGCCGGGGGCCTGGGACTCAACCTGACGGCCGG
CAACTACGTCTACGTCATGGAACCACAGTACAATCCCGCAGCCGAGGCCCAGGCCATTGACCGGGTCCATCGGCTAGGCC
AGAAGCGGCCTGTTCACACCGTTCGCTTCATCATGAATCGGAGCTTCGAGGAGCGCATGCTCGAGATCCAGGCCGACAAG
ATCAAGCTGGCCAACCTGTCGCTCAACCGCGACCGCATGGGCGTTGCCGATGCCGCCCGCCAGCGTCTGCACGACCTCCG
GCGACTCTTCCGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62