GenePrediction:GLEAN_634 Details

Name: GLEAN_634
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1119206..1122326 (+ strand)
Length: 3121
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1119206..1119422 (+ strand)
Length: 217
Type: CDS
Source: GLEAN
Position: GCSC_97:1119553..1120946 (+ strand)
Length: 1394
Type: CDS
Source: GLEAN
Position: GCSC_97:1121009..1121843 (+ strand)
Length: 835
Type: CDS
Source: GLEAN
Position: GCSC_97:1121911..1122326 (+ strand)
Length: 416
>GLEAN_634 class=GenePrediction position=GCSC_97:1119206..1122326 (+ strand)
ATGATTGCTGCTGACTTCGTACGCGCTAACCAGGCTCAGTCTTCCCGATTTACCTCCTACGGGAAGGCCAATTCGAGAGA
CGTTTCGTCGTCGTCGGCATCGTCTCAACAGCGAAACAGCTTCTCTTCGAACTGGAGTCAACCGAACACAGGGAGCCTTT
GGGCAACACACATCCCTTCGCCATTCGCCAACCGTGATTCGCAAACCAGTCTCTCAGGTGAGTACTACATCTGAACGCTA
AAGCAAGAACCAGTAGAAGAGGAAGAACAATGATCGGTTGGCGAATACTGCCTCCCAATACGCCGAATACGCAAGGCTAA
CGACCCCGTCTGTTTGTTTGTGTCTAGGTCACGATGAAGCATTCTCGAGTAGCTCCGATGCCGCGAATACCTTTCCAGAC
GCATCTGCTGTATGGCCACACCCAGGTGCACATACGACCAGATCCTGGAACAGTACCGATAACACCGCCTCTCGGAGACC
CTCGGCCAGCCCGTCACCAGTACATATGAGGGAATCCTCGCAAACGTATCACGAGCACTTGCACGACCGCACACCCTCGA
CTACCAATGCCTCCTATCTTGCTGTCAGAACCTCTTCTGGCAGTTACGCCCCTTCCCGGCCCAGTGCTGGCCCATCTCTA
GATTCCAATGCCGCTCCTTTCCGATTCCCGCCCCCACGGTCCTCTCTGCGCAACGGTATAGTTGATGTCGATGGCGAGGC
CAGCGTGGCATCTTCGTACCCGTCGTTCGGCTTCGATACAGAGCCACTGCCACAGCAGGATCTGGCAAACGGTTTTAGCA
ATGCTTCCGCCACGGCTACAGGCTCTGGCTCCTCCATATCCACATCTGTGGCGGCACCTGTGCCAGGCGCCGCCAATTCC
GGAATTGCTACCTCGATAGCTTCGCTTAGTTCTTTTGGCTCCATGCCACCATCCTCGCACAACGGCCATGCTCGCCGGCC
ATCTCTCCAAGCCCAGGCGTCCTTCTCCTCACCAGCACCCTCTACAAGCCAGCTACCCCATCAACGGCAGCCACAATCAG
ACGACGCGGTATCGTTAGCCTTCGCAGACTTGATGATGCGACAGACATTGAATGCAGAGGATCGACAGGACATCGGTGCT
GGCCTCACCGGCACATACCCAGCATCGACGCCCTTTGAATACAATCCTGTTTCTCAAACCTGGGATGCTACTGATCCGCT
CAGGGCGGCTAATTTTGCAGCAGCCCGCGGAACCCTGGCCGGGCTTAATCGCGGTGTAACTCCAGTGGGCAACCAATTCC
GGCAAGCAACGGGTCAGCGAGGCTTCGGCGCTCCTGCTAATGGCACTGACCAATGGGGCCGGCCTGTCTCTCGCGATCTG
AGGGCACCGGGCTCATACGATGGTTTCAATTGCTTCAATAGCGCCATGGGGCTGCTGCCTCGTCCGTCGCCCAACAGCCT
CACCCAGGAGGGATTGCAGCAACTACAGCAATCGCAGCTGCAGATTTTGTATCAACAGCAGTTACATCCGCAACAGCAGT
TTACCGGAGCTCCCAGTCTGTTCCCAACCAACTTCAGCTCCAATGTTAACGCATTTCGAACACCTGTAGCAAACCCACAG
CTTAGTCTCCATTCACTAGGCGTTCAGTACATCGCTCCAAACGCACAGGTACCTCGCGACAGGGATCCCGCCCAGGCCTT
CAGAAGCCCGCTTTTGGACGAGTATCGTGCAAGCAGGACGAGCCGGAGGTTTGAGCTTAAAGTACGCATAGATGCATACT
GTTTCTTTGCAGGTGCCCTGGTTTGTGCTAACATTTGCAACAGGACATCTACGATCATATTGTTGAGTTCAGTGGCGACC
AACACGGTTCCCGCTTTATTCAGAGCAAGCTGGAGACAGCGAATAGCGACGAGAAGGAGCATGTGTTCCGTGAGATATCG
GCGAATACGCTCGTGTTGATGCAGGATGTCTTTGGCAACTACGTCGTTCAAAAATTCTTCGAGCACGGCAGTCAGCTGCA
GAAAAAGTACTTGGCCGAACAGATGAGGGGCAAGATAGTGGACCTGTCGACGCAAACATATGCCTGCCGGGTGGTACAGA
AAGCTCTTCAGCACATCCTTGTCGACCAACAGGTGATCTTGGCTAAGGAGTTGGAGATCGATGTGATCCGAGTCGTCAAG
GACCCCAATGGTAACCACGTCATCCAGAAGGTTGTCGAGCTAGTACCTCGGGAGCACATCAACTTCATTATCGATGCCTT
CCGTGGCAGAGTAAGAGAGTTGTCGGCACACAACTACGGATGTCGTGTCATCCAGCGGATGCTCGAGCACGGGCTAGAGG
AAGATAAGGAAATGATCCTGTCAGAGCTCCACGACAACGCCATGGACTTGATCAATGACCAGTACGGAAACTACGTGGCA
CAGCACGTCATCCAGTTTGGGAAGCCCAGAGATCGAGAAAAGGTGATCAGCAGAGTGCTTAATCAGCTCGTGACCATGTC
CAACAACAAGTTCGCATCCAATGTCGTCGAGAAGTGCATCGAATTCGGCACGGCCGCAGACCGCCAGCGGATCCGAGAAG
AGCTGAGTCGGCTTGGTCCCGATGGGCAGCCGATCTTGCAGCAGATGATCAAAGATCAGTATGGCAATTATGTGATCCGT
AAGTCAAGCCTTCGCCTGTTCTGTTAAAGTCCAGCAACTTATTATTGCCCTTTTATCGATTGTAGAGAAACTCTTGAAGC
AACTAAAAGGTGAGGAGCACCAGCTCTTTGCTGAAGTACTGTCGGTCCAACTGTCAGTGCTGCGGCGATCGAGCACAGGG
CGACAGAATGCCGCCATCGACCGTCTCGCTACGGCGATGGAGGAGACGTCTAAGGGAAACAATGCCAGCGGCCAGGCGCC
GTCAGGCAAGAAGCCAAATGGTGATTCTGCTTCACAGGCCTCGCCTCAGCTATCGGGCGACCAGGAGTCTACTCCGTCTC
TGGCAAGCTTACCAACGACCCCCGAGAGCTCTAATCCTCCTAGTGTGAGCGCTGGCTCGTCTGGGGGCTCGCTGGAGTCT
GAAGACAATGACTCGACAGCGACTGCAAAAGCAGTGGATGCCAGAGAAAATGCCGCGTGTCTAGAGACGCAGGTCGTTTG
A

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62