GenePrediction:GLEAN_6357 Details

Name: GLEAN_6357
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:646118..644550 (- strand)
Length: 1569
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:646118..645966 (- strand)
Length: 153
Type: CDS
Source: GLEAN
Position: GCSC_144:645893..644550 (- strand)
Length: 1344
>GLEAN_6357 class=GenePrediction position=GCSC_144:646118..644550 (- strand)
ATGCTGGAGGTTTCAGTCAACGGACTGCACGTGAACCTGCAGTACTGTCAGGCGGCAGTGGTGGCCGAGACCTGGCCGGC
CGTGCTCGTCGTGGCGGCCGATCACGCGCTCATCACGACGCTGTCGCCGCAGACGCTGTCGAGGCTCAAAGCCGTGCGGG
ATCTGCACGCCTTGCGCGCACCCTTCTCGAAGGGTGAGGGCCGGTGCACAGCCGAGCACTTCTAGACGGCCTATCGCTCC
ATCAAGACGTGGGCCCGCTCTCGTGGCCTCTATGCGGCGCGCTTCGGCTACCTCGGCGGCATACAGATCGCCGTGCTGTT
GGCGCGAGTAATGAAGCTGATGGCAGCTGCAACAGACGACGACGACGACGACGACAGCAGTGCGGTGCCCGACATCCTGG
CAACCTTCTTCCGCGACTATGCCGGTTTTGACTGGGCGACGCAGATGGCCTTTGACCCGTTCTTCCACGGCCACAAGGCT
CCGCATGTTCGGACGGCCGGCGAGCCGCTCGTGATTCTGGGCTACCACCGGCCGCAGCTCAATACGAGCATGTCAGCGTC
GGTGTCGTCGGTGCGTGTGCTCGCGGCCGAGCTCCGGCGTGCCGACCGCTTGCTGAGCGCCGGCCGAATCAGCTGGGATG
CTTTTCTGGGCGGTGGAGGTGACGAAGGAGATAGCAGCACAATCGTTGCTGGCAGGCTTCTGTCTGGCGCTGCCACATTT
GTGTGTGCCTACCGGACGTACGTCAAGATCGACCTGCAGTATTGGGGCCTGTCGCTGCAGCGAGGCGCCTCGTTTGTCGG
CTGGCTCGAGTCACGCTGTGCGATGCTGCTGGTCGACGTGGCGCGACGACTGCCGCAGCTCAACACGCACATCTGGCCAG
GGCGGTTTGTGGAAGGGGATGAGGGGGATGGAGAGGGTGACGATGCAGAAATTGGTACAGAGACCACGCAGTATCAGGGC
TGCTACCTGATCGGGCTCGATCTGGCGGCGTCGCTCTCGCGGGACGACCGACGCATTGCGCTGGACACGCTGCAGTCGGT
GCTTTCGACGTTTGAGCGACAGATGCGGCGATCAGGTGGCGAGTACGATGCGCAGTGGATGTGGCTGGGCGTGAGCATTG
CGAGCCGGACGGATCTGGGCGATGTCGGCCGTCTGCGGCTGGACGAGCGAGCCTGGTACACGTCGGAGGAGGAGGAAGAG
GAGGAAGAGGAAATTGAAGAGGAAGAAGCACGGCCCAAGAAGAAGGACAAAAAAGACAAAAAGAACAAGGACAAGGACAG
ATTCAAGGCAGCGTCCCAAGTGGGCACAGGCAAGAAGTTCCGGTCGGCGCAGGATGTGATCAAGCGGCTACGCTGGGATC
CGCAGCTAGACCGTGCTGACTACGTTGTCAGATACGAAGACCGTTTCGTCGGCGCGCAGGAGCGGCCGCTCAGCGCGTGG
AAGTCGGAGCAGACGGACGAGGAGTTCATCCCGCAACACCGCGTGCTGTATTTTCGGCGGCGCAGCGACGGTGCCGTGAT
CTGGGACCGGCGAGCGCGCAAGGACGAAGTGTTTGGGAGCGGGATGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62