GenePrediction:GLEAN_6360 Details

Name: GLEAN_6360
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:636128..633746 (- strand)
Length: 2383
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:636128..636029 (- strand)
Length: 100
Type: CDS
Source: GLEAN
Position: GCSC_144:635960..633821 (- strand)
Length: 2140
Type: CDS
Source: GLEAN
Position: GCSC_144:633764..633746 (- strand)
Length: 19
>GLEAN_6360 class=GenePrediction position=GCSC_144:636128..633746 (- strand)
ATGCGTCTTGCATTGCAAAAGACGCTCGCTCAGCGCGCGCTCTTGCTCTTGCAGACCTTGGCTATCTTGAGTCCTGTCGT
AAAAGCCTTTTACATTCCAGGTTCGTTCTTGGCGCAATGCGAAGACGGCCTCTCCCTCAAGCTGACTGTGCTGCTTCTGC
TTCTCCAGGCTGGTCGATCAGGAGCTATGCCGACAAGGAACAGATCCCACTACTCGTCAACAAGGTATATTCGGACAACA
CGCAGCTGCAGTATGCCTACTTCGACCTCCCCTTTGTTTGCCCGCCGACGGGGCAGAATCGCCACGGCGGTCTTCTCAGC
GGACAAAGCCTTCCGCTCAACCTGGGCGAAGTGCTGCGGGGCGACCGAATTACAGCTTCCGACGTAGATCTCACCATGGG
CCAGAACACCGAGTGCAAGTATCTCTGCACCCGGGACATGTCCCGGAAGGAGCTGAACCGTGCCAAGCAGATGGTCCGCG
AGGGCTACGTGGTTGAGTGGATCGTCGATAATCTCCCTGGAGCCACCAGCTTCGTCACCGTCGACAAGACACGCAAGTAC
TACGCCGCTGGCTTCAAGCTTGGCTTTACCGACTCATCTTCGGGCAAGCCCCGCTACTTTCTCAACAACCACCACACTAT
CGTCATCCGCTACCGCAAGGCTGCCGGACACGCCGGCGAGCGTGGGAAGAAGATCGTTGTCGGCTTCGAGGTCTACAGCA
AGAGCATCGGCCCTACCAACAAACGGCTGGAGGACGGCTGTCCTGCCGACCTGCGCACAATCGACCAGAACTTTGAGCTC
TATCTCGCCCCCAACCGCTCCTCCACCCCGGAAGACAAAGCTCGATACGAGCACTCGTCGTACCACCCGGACCCCTCTGA
GGATTACGGTGCCGAAGACGACGGCTCGCGCCTCTCGATCCCGTACTCCTACTCTGTCTACTTCCAGGAGGACAATTCGG
TCGAATGGGGACACCGTTGGGACCTCTACTTTGTCAACCAGGAGGAGGGCTCCAAGATCCACTGGCTGGCCATCATCAAC
TCGCTCATCATCTGCGGCCTGCTCACCGGCATCGTGCTGATTATTCTTGCCAAGACCATACGCACTGACATTAAGAGTTA
CAAGGATGCCCTGGTCGAGGAGGGCAAATCGCGCACAAAGCGACGCAGCCGGAGGGCTGTTGGCCAGAGCGGCGCTGGGT
CTGGGACTGGAAGCGCGACCCCGACGGTGGGCGAGAAGGTGCCGGTCTCAAGCGTGGGCGTTGGAGTCGGTCTCGGCCTG
CTCGACCAGGAGGCTGATGCGGCGCTGTCCGGTGGCGACGATGAGGCCCTGTCCTCGGGCGACGAGGCCTTGGAAGATGT
GACAGGCTGGAAGATGCTGCACGGCGACGTATTTCGAACTCCGGTCCACGGGTCGCTGCTCGCCCCTCTTGTCGGCTCGG
GCATGCAGCTGCTCTTCATGGCCTTCAGCCTGGTCTTTCTAAGTGCGGTCGGTATCCTAAACCCCAGCTTCCGGGGCGGC
TTCGTCAGCTTTGCCATCGGCCTGTTTGTCTTTGCCGGAGTCTTTTCCGGCTACTTCTCGGCTCGGGTCTACCGCACCTT
TGACGGCCAAAACTGGCGCCGGAACACGCTCGTTACCGCCATCCTGTTTCCGGGGCTGCTCTTCAGCGCCGTCTTTGTCC
TGAACCTGTTCGTCTGGGCACAGGCTTCGAGCACGGCCATCCCGTTTGGGACACTCATCGGCATCCTCCTCCTCTGGGTC
GGCATACAGGTGCCTCTGGTGTATGTCGGTTCTTGGTACGGCTACGTGCGAATCGGTGCTTGGGAGCATCCTACCAAGAT
CCATGCTGTGCCACGCCAGATCCCTCAACAGGCATGGTATATTCGCGACGTTCGGACGATATTGCTGGCGGGGCTTATTC
CGTTCGCGGTAATCTTCATCGAGCTTCTGTTTGTCTTTCAGTCGGTATGGCAGGACAAGAGTGGCTACTACTACGTGTTT
GGTTTTCTGTCTGTCGTATCGACAATTCTCATTGTCACCATCGCCGAGGTGACCGTTGTGACGATCTACATTCAGCTGTG
CTCGGAGAATTACAACTGGTGGTGGCAGTCGTTCCTCGTCGGCGGCGGCAGCTCTGTCTGGGTCTTCCTGTACTGCATCT
GGTACTACTTTGCAAAGCTGCACATTACGGGCTTTGTGAGCAGCCTGCTGTTCTTCAGCCACAGCTTCATTGCCTGCTGT
GTGTACGCCCTGCTCACCGGAACGGTCGGTTTCCTGAGCGCCTACGCGTTTGTTCGTAGGTTATACGGGTAAGTTGGACC
AGACAAACTCTCTTCTGTACGAGTCTCCATTCTAACCGAACCAGTGCCATCAAGGCGGATTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62