GenePrediction:GLEAN_6361 Details

Name: GLEAN_6361
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:633114..630653 (- strand)
Length: 2462
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:633114..632826 (- strand)
Length: 289
Type: CDS
Source: GLEAN
Position: GCSC_144:632768..630764 (- strand)
Length: 2005
Type: CDS
Source: GLEAN
Position: GCSC_144:630698..630653 (- strand)
Length: 46
>GLEAN_6361 class=GenePrediction position=GCSC_144:633114..630653 (- strand)
ATGTCCGCCCAATCGAGCAAATGGCGCGAAGAGCAGATTCTCATCCTCTGTCCTGGCAGCCGCACGACAATGGCCCAGCT
CGGCTGCCACGAGCTGACGCCGCCGGCATACCGGATTCCGACACGCATGTTCCGGGACGAAGACTCGGACGAGTGGCGGC
CGTACCGCACGTGGAAGCGCAGGAAGATGACGGTGGCAGCTGAGGACAACGGCGCTGCAACCGACAAGGACGAGTGGGAG
TACGTGGAGGACCCGGACTCGGACGAGGGTGCTGTGCATCCAATGGAGGGTAAGGCTTTGTGGCGGGGGCTCGCAAGGAC
TGCAGAGTGCTAACACGGGTAATCAGGCGGCTACATCACCAACATGGAGGCCTTTCTCGCCTTTCTCGAGCACGTGCACG
GCCTCCTGACGACGACGTACCACAACACGCCGATCGTGCTGATGGCGTCGCCGCAGTGGACGCGACCGGACTGTGAGGCC
ATCGCGCTATACATCTTTGAGAAGACGCGGACGCCGGCCTTGTGCATGATCAACAGCGCGCTAGCTACACAGTACGGCCT
CAAGTGGCCACACATGACGGTGGTGGACATTGGGTTCGAAAAGGTCGACGTAACGTGTATCTACGACAGCCGGATTGTCA
ACCACATGGACATTGGCTACCCGGCCGAGCCGGGCGAGGACCGGGTGATCTCGGGCGGCGAGGTGTTTACGCAGCGGCTG
GTGGAGCTGCTGCGGCGAAAGGACTTCACGTACGAGATGGCAGAGCAGCTGAAGAAGAGCGCGATCTGCGAGGTGTTGCC
GTACGCGCCTGACTGTCCACAGCTGATGGAGCTGCCGGAGGACGAGCCGGGGGCAGCGCTGGTTATGGCGCCAGTGGTGA
CGATCGAGCCGGTGGTGGTCGGCGACGGGTCGCTAGCAGTTGCAGCGGACGTGGACGCCGATCTAGCGATGGAAGACGGG
GTGGTGGCGGCTGACAACGACGGAGTGCTGGACGTGGCGGCCATTGTGACGACGGGACAGACAAAGGAGTTTCTGGCCAA
GAAGGAGAAGGAGAAGACGGAGCGAGGCCGCTTTGGACGGCGGGCAAAGGAGAAGGAGGCCGAGGCGGCCAAACCGGTGC
GGCTGCCCAACGCGAAGCGGGCGCGCACGATATTCCACTTTGAGGAGCTGATCGAGGACGACGAGCCGCCGCAGCAGGCG
AGCCATCGGGGCAGCGGAGCTGGCGATGGTGGCGCTGGCGGAAGTGGCGGTGCAGGTGGTGCAGCAGGTTCGACGAACGG
CAAGGCTCGTGACGAAGACGCAGAGGGCAGCGAGGATGGCTCGGACGCGGAAGGATCCGAGATGGACGAGGACGAGGACG
AGGACGGCGAGGGTGAGGGCGAAGGTGAAGGCGAAGAGGGCGATGGAGGGGCAGAATCCAGAGAGGCAGCAGAAACCAAG
ACGGAAGAGAAGACTGCGTTCGTGAAGCCCGAAGACGGTGTCGAGGCGGCTGATAAGACGACGGAAGCAGAAGCAGCAGG
AGCAGCTGCCATCACAGGCGAAGACGCGACGATGGCGGATGTGGCAGCAGCCTCGGAGACCACGGAGACCAAGGAGACAA
AAGAGGTGCCAGCAGGCGAGACGGCCGAAACGACGCAGCAGGCCACAGCAGTCCCGTCAACGCTATCGACAGCGGCCATG
GCAGCCGTGGCGGCCGAACAGCAGGGACGCCGGTTCAAGCGACTGCGACGGGACCTGGAGATCGGGCTGGAGCGGTTCAC
GTTTGCGGACCGGACGGAGATTGACCGGATCGTCGCGACGATTTACCGGACAGTGCAGGGAATCCAGGACATGTACATGC
GGCCGTCGTGCTGGGAGAATCTGGTATTTGTCGGCAACGGCAGTCGGCTGCGCGGATTGCGTGAGAACATCTTGCAGACG
CTGCAGAGCCGCCACCTGATCTCGCCCTCGACCGCGACCATCTTCACGTCCGAGCTGCCAAGTCATCTGGGCACACCCAC
GGGCACCGGTGCCCAGACGCCGACCGGCAGCGGCTTCTTGGCACCGGCAGCTGTGTCGACCTCGGTCAACCCACTCCTGC
AGGCTGCCACCACGGCGTCGCTCGGTGGACCTGGTTCGGTCACCGGCGCCGACGGCTCTTCGCACGTGCACCACTTCCAC
GCCCAGACTCCCACGGCTATCAAGACGGCCGTCTTGCCGTCATACCTCAGCGAGTGGACCAAGAACGGCTTCGAGGAGGC
CATGTTCCTCGGCGCTCAGGTCGCCGCCCGTCTCGCCTTCTGCGTCCACAACCTGGACGCACAGGGACTCGAGAGCCAGC
GGCTGATGTACCTTAGCCGCATCGACTACAAGTGAGTGTGCACTGTCTCTTTGTCTCGTTGTTTGTTGTCCAACCTATAT
GCTGACGTAATCACAGCGAGCTCGGCCCCAAAGGCATCCGGACACACTCCCTCCTGGGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62