GenePrediction:GLEAN_6365 Details

Name: GLEAN_6365
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:608987..607316 (- strand)
Length: 1672
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:608987..608850 (- strand)
Length: 138
Type: CDS
Source: GLEAN
Position: GCSC_144:608751..607579 (- strand)
Length: 1173
Type: CDS
Source: GLEAN
Position: GCSC_144:607510..607316 (- strand)
Length: 195
>GLEAN_6365 class=GenePrediction position=GCSC_144:608987..607316 (- strand)
ATGGCAGACAGCACAGCACCGGTTGTCGAGGGCGCAGCAGCAGCGGGGAGCAGCCGGCCGGTCAAGCCCGATGAGGCAGT
TTTCCAGAAGGCGCTGGACAAGGCCGAGAAGGAGCACAAGGATGTGATGACGCGGTTTGTAAGTAGCTCAATCGACGGCC
GGGCGGCCCAATGGGCGGGTGGGAGGGAAGAAGAGAGGAGTGCTGTCCCGACAGCCTGCTAACGCGGCCGCTTCAGAACG
CCATCAAGGCCAAGATCGAGCTGGCGCAGCCGAACAAGAGCAAGGACGGGCCGCAGTCGGCGACGCAGAAGCGCCGACAG
GAGCTGATTGAGCAGCTGACGGAGATCCGGAAGAAGCAGGCGGGCGGCAAGTCGGCGCGGACGTCGAAGCAGGAGCAGAT
CAAGCGGCTGGACGAGCAGCTGCGGAGCCGGATCGCCGAGCAGAAGACGGCCAAGAGCAAGGTAGCCTTCAAGTCGACCG
AGGACCTGGACCGGCACATCCAGCGGCTGGAGGACCAGGTGAACGGCGGGATGATGAAGCTGGTGGACGAGAAGAAGGCC
CTGTCCGAGATCACGAGCCTGAAGAAGACGCGCAAGAACTTTGCCCAGTTCGACGTGCAGGAGAAGCAGATTGCCGATCT
GCGCGCCAACATCAAGCAGATCAAGGACAGCATGGACGACCCGGAGGCCAAAGCCATGGGCGAAAAGTACAACGCCATCC
AGGCCGAGCTCGACGGCATCAAGGCCGAGCAGGACGTGGCCTACAAGAGCCTCTCAGCCCTGCGCGACGAGCGCAGCAAG
CTGCACGCCGAGCAGCGCGACAAGTTCGACGCCATCCGCAAGCTCAAGGACGACTACTACGGCCAGAAAAAGGCCTTTGC
CGCCTACGAGCGTGAGGCCCGCCAGAAGGCCTGGGAGCGCAAGCAGGCCGAGCGCGAGCGCTTCGAGCGCGAACGCAAAA
AGGAGCGTGCACAGCGCCTCTTGGCCGAAGCCAGCGACCCGGCCTACATTGACGAGATCCGCCGCGCCCGCAGCCTGCTG
CACTTCTTCGACCCCACGTCCACGCCCGCGCCCGCGCCTGCTGCCGTCGCTACCGCTGCCGCCAGCCTCGGCGCCCAGGC
CACCCGCAAGGTCGACGACTCCGGCCTCAAGGGCACCCGCCTCGTCCGCAAGGAGGACCGCGACGACACCTACCTGCCCG
CTGCCAAGAAGGGCGCCAAGAAGTCCGCCAAGAAGTCTGCTGCCGACTCTGCCTCCAAGGGCTACAACGTGCCCCCGTCC
GTCATCGAGGACTGCGCCTCCATGGGCCTCGACCCGCCTGCCAGCCAGGCTGATGTCGCCGTCGTCATGGAGAAGGTCAA
GGCCAAGCTGGCCCACTGGGAGGCTGACCAGGAGACCCAGACCCAGCGGGTGAGTTTCTTTTATCATCTTTCCTTCTTCC
TTCTTGCCCGTCCTCCGCACCCTGCTGACCGGATCAGAACATCGAGAAGGCCAAGAAGGAGATTGAGCGGATCGAGAAGG
AGGAGGCCCAGGAGATCGCCAAGGCCAACGGGAAGCAGGCCGATGAGCCCAAGGCCGTTGCCGAGGTCACAGCCGAGCTG
AAGAACGCCTCCATCGAGGACAAGGCCGAGGAGAAGAAGGACGAGGCCGACAAGGAGGAGACAAAGGCGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62