GenePrediction:GLEAN_6366 Details

Name: GLEAN_6366
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:588426..587676 (- strand)
Length: 751
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:588426..588400 (- strand)
Length: 27
Type: CDS
Source: GLEAN
Position: GCSC_144:588334..588202 (- strand)
Length: 133
Type: CDS
Source: GLEAN
Position: GCSC_144:588148..587676 (- strand)
Length: 473
>GLEAN_6366 class=GenePrediction position=GCSC_144:588426..587676 (- strand)
ATGCTGTTCGAAGAGGACCCGTCGGTCGTAAGTGTCTTGGTGCTGGTTGCCGAGGCGGATTGCGGGATGCTGACACGTGC
TCTTGTCCGCAGCTGATCCAACATACCGTTGACAACTTCAACATTGGGCCCGACAAGGCGGCCGTTGCCCGCATCAAGGA
GTCTCTGGCGACGCTGCAGGAGGCGCGGCAGCTGCAGATCGAGCAGACAGAGACCTCTCTCAAGAGTGTGTGAAGCAGGC
AAGACGACCAGAGGAACAGTGCTGACTCATCTTCCTAGAGCTGGCCCGCCAGCTCAACACGCTCGGCTCCCAACACGACG
AGCTCGCAGCCAAGCACTCGGCGGCGGCGCACGCCTCGACCATCTCGGCGCTCGACACGGAGAAGTTCCGCGTGGCCAAG
ACGGCATCGGACCTGGAGATGGAGACAGAGCGGCTCTCGGCGCAGGCGGCAGACCTGTCGGCGCGGCTGCAGGAGCTGGA
GCTGCAGGGCGATGACGGGCCGGCAAGCAGCGATGGCGGCAGTGGTGGAAACGGCAGCGGCAGCGGCGGCAGCATGGCGA
CCGAGGACGAGGTGCTGCTACGGCTCAAGGTGTACCGCAGCCTGGGCATCGAGCTGGAGCGCGACGGCCGGGAGGGCGAG
TGGACACGGGCCGTGGTGCGCAACGACCGCAAGGGTGACGTGCACGTGGTAAACATGGACAAGAAGTTCTCGCGATTCTT
CTACGCCAACTACTTCTGGCAGACGCTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62