GenePrediction:GLEAN_6368 Details

Name: GLEAN_6368
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:577715..574255 (- strand)
Length: 3461
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:577715..575052 (- strand)
Length: 2664
Type: CDS
Source: GLEAN
Position: GCSC_144:574989..574255 (- strand)
Length: 735
>GLEAN_6368 class=GenePrediction position=GCSC_144:577715..574255 (- strand)
ATGAGTGAACTGCAGCGGTCGGTGCTGGAGTTTTACCAGATCACGACGCCGTATCCGGAAGAGTGGCCAGAGACGAAGAA
CAATGCGAGCGACGCGTCGGATGACGAGGATGCCAAGCAGCGGCAAGCGAAGCTGAACCGGCGCAAGTCGCGGTACCAGG
TGCTGGAGCGGACAGCGACGAACCGAAGCAGCACGGTGCCAGGATCGGAGAAGGGGAACCTGGTGCAGCGCGACGAGCCG
GATCCTCTGGGGAGCGGCGAGAGCGTGGTGGAGATGCTGAAGCGCAGCCGTGCGGCAGGCAGCATCAGCATGACGATCCA
GGATGACGCACAGCTGCGCAGCCGGTTTCTGCTGTCATCGACGAGCTTCTCGCCGGCGCTATTCCTGTCACAGGTGCACA
CCGACGACAGCACGGAGACGCTGGTGGCCGGACTGGACGCGGTGTCACGGTCGATCGACCAGAAGTCAGCATCGCTCAAG
GTGCTGGTGGAGTCCAACTTTGAGCGATTTGTGCGGGCCAAGGCAACGATCGACAACGTGTACAAGGAGATGAAGTACCG
GGGGGTAGATCCAGCGACGGCCGAGGCGGCCACGACGCCGCGAACACGAGCACACTCGCGGCACGCGAGCCGCAACAGCT
TCCGGAGCAGCATGAGTGCGGCGGGACTGGCAGGGGGAGGACTAGCAGGCGGACTGGCAAGTGCTCTGGCGGGCGGCGCA
GGCGTCGGGACAGCTGTGACGGGACCAGAGGCAGACAGCAGCCGCAAGCGAAACGCGCTCACCAAAGAGAGCGAGTACGG
GGTGCTGGGGATCAAGCAGCCGCTGGTGGAGGTGTCATCCAAGGCGGAAGAAGTATGGGGGCCGGCACTGGGCGGACGGG
CAAAGGAGGCAACGCTGCGCAAGGTGTCGGGCGAGCTGGAGCGGTTCCACGACTACGTGGAGGCGGGCGCAGCCATCACG
GACTGCATCAAGCGCAACGACCACGAGAGTCTAGTGGAAGAGTACCAGCGGGCACGACGGTTTGCGGAAGAGGCACGGGC
ACTGGCGGTGCAGCTAGGGGGCCAGACGGCACGGCCGCCGACGGACGAACAGCTGCAGCAGATCGTGGTGGCAGCGAGGA
TGTGGCACGACGTCGAGGAGCAGATCCAGGCGTACAAGCGTGACGTGTGGCGCAAGCTGACGTCGGCGCACGGGCCGATG
GTGGCGTCGATGGTGGCGACGCGAAGCGGAGGAGGAAATATGGGCAGCTTTGGCTACTCGACAGCAGGAGTTCGAGGCAG
CGGCCAAGGCGGCTCACGCGACCAGCACATGGAGCTGATCGGGCTGCTGCTGGAGCTGGGCGTGGACGACAACCCGATCT
GGGTCTGGCTGCTGAGCCGGTACGACTACCTCAAGGGCAAGATCCAGGCGACATGCGAGCACGCCAAGGTGGAGATTGAG
GTGATGCGGCGACGTCTAGCCGAGGCTGAGAAGCCGTCGCCAGCAGCGATCGCCTCCCATCTGCGGGCGCTTGGCCGTGG
CACCATCGAGGCCAAGATTGCGTCGCTGGACGCGCCCGACGTGATCGAGATGTGGGACAAGGTGCTGGCCTTTGCAGCCG
GTCTGCTGTCGGCGCAGGGAATCCTGGGTGAGGTGGTCGAGTTCTGGCAGACCGTTGCCGGCTTCGTCGACGGCCGCACC
CAGACGTCGCTGCCGACGGGCTTTCGCGGCGAGTCGCTGCACCACCATCGCCTGGCGCCGGGCAGTGCTGCCGACCTACA
CAAGGGCGCCCTCGAGCTGGTCGATCTCGTGCGCGAGCAGGTTTACGGCTTCTTTGCCGGGCCACCGCCCGAGGACGTGT
CGCTGCTCTTCTCGCCCGTGCCGCCGTCACCACGCACGCCCGTGCCGTCGTCGTCCGTGCCGGCCTCGCCTGTCACCCCG
CTGCAGCGTCTCCGCTTCGGAGCCCCGTATCAGCCGCAGCAGCAGAACATGCCGCCGCCACCGTCACACAACGGCGAGGC
CTGGGAGAAGTTTGCCTTTTGGCCGCCGTGGTCCAACTCTGTCAGCGGCGTCCACTACCTGTCCGAGATGCTGGCTCTCG
TCGGCGCTGGCGCTACTGAAATGGCTACTGTCGGCACTGGTATCGAGAGCGACGGCATCGCCACCGACACCGCCGACGTC
GACCGCCTGCGCACGCTCGTCGGCGCCGTGCGTGAGCGCTGCGCCACCGCCTTGTGCGCGGCCTGGAACCGCGACGCCGA
GAACGTCAAGTACCTCGAGGACTGGCACCGTGCTGCTGATCGCCGCGACGTCACAAAGATGCCCGCTGCCTTTGCCGCAT
TTGAGGGCGCTGTGCTCTCGGGCATGCAGAAGATCCTGTACGTGTCCGAGGCCATGGCTAAGCCCGGCGCTGGCGACATC
GTCCTGCCCCCATCTGCCAAGTTGCTCCAGATGGTCCGCGCACAGTACGTCACCACCCTCTATAAGGCTCTCAGCGGCAT
GGTTGAGAATGCCGAGCGGCCGCTCAAGAAGGCCGACGACGACTGGACCACTACCGATGGCGACGGCCCCGGCACCAGCT
ATGTCGCCGTCACTGCTGCTACCACCATTGCCGCTACCGGGCCGCTCGCCGACAGTCGTGTTGCTGCCATCCTCGACAGT
GGCGCTTTCAATGCCGGAGACCGGGTGAGTGGTGTTTGCTGTCCGTGCTGTCCGTGCTGACTAATGCTGACTAATCACAT
CAACAGAATGTCCGCATGCTCCTCACCCTCAGCAACCTGCAGAGCCTGCGGTCCGAAGTGGTGCCGCGCCTCAACACCCA
GTTTGAGAATGCCTTCTCGGTCAAGCTGACGGACGAGACCAAGACGATCCGCGATGTCCTCGGCCAGATCGATACGCGCC
TTTTCCTCTCGTACACGCGGCCGTCCGTTGACGCGCTGCGGCGCATCGTCCGGGCCGGCGTGCTCGACAGCAAGAGCGGC
GGTGGCAGTGGTGGCACCAAGCCCAGCGAGGCGCGCCCGTACGTGTACGAGGTGCTGCTGCTGCTGGTGCTGGTGCACTC
GCAGGTGTCGACGACGGCGGATTCGCTGACTCAGCAAGTATTATCGCACCTGCTGGAACAGACGTCACGTGAGCTGCTCG
AGGCGCTGAAGCAGCAGACGGCGGCCGGCGTGCGCTACGATCTGGCGGGCCTGATGCAGGCCACGCTGGACGTCGAGTTC
ATCGCGCAGGCCCTGAGCCAGTACACGACCGAGCGGGCCAGCGAGCTGCAGGGCCTGATCTACCAGGAGCTGGATGGCCG
CACCGACAACGACGCGCGCGCCCGCCTGCAGAGCGAGCTGCCCGAGATGCGCAGCGTCCTGAAGCGGCTGCGCGAGGCCA
GCAAGAACGAGTTTGCCTGCTTCCGCAAGCCGAAGCGGGCGGGCGCTTCCGGCTCGGGCGGAACGAGTGGACGAGGCAGC
CCGAACACGTCGGTTACTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62