GenePrediction:GLEAN_6369 Details

Name: GLEAN_6369
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:562309..558624 (- strand)
Length: 3686
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:562309..562252 (- strand)
Length: 58
Type: CDS
Source: GLEAN
Position: GCSC_144:562187..562117 (- strand)
Length: 71
Type: CDS
Source: GLEAN
Position: GCSC_144:562046..558624 (- strand)
Length: 3423
>GLEAN_6369 class=GenePrediction position=GCSC_144:562309..558624 (- strand)
ATGGAGGACCAAGTACACAAACCGCATAGGAAGCCGAAGGAGAAGAAGAAGCATACCGGTAAGCAACAGACTCGGAAACG
GACTGGCACTATAAGGGTTCAAGCTGACAACTTTCATTACAGGGCAGAACCCAAAGGCTTTTACTTTCTCAAATCCCGGC
AAGCTCGCGCGAAGCGCTGCTCGTTCGCATGATGTACGTGATTCTAGCCAAGGAGACAATGCCTCAATGGGGCAACATGC
TTACGATTATGTTTCACGTGTAGATCAAAGAGAAGCGACTTCATGTCCCGCTTGTTGACCGACTTCCCGATGAACCACCA
CCGCGACTAGTCACGATTGTTGGCCCTCCGGGCGTGGGAAAGACGACACTGCTGCGGTCTCTCATCCGGAGATACGCAAA
GGAGACGATTATAGATCCACAGGGCCCGATCACGGTGGTCACGTCGAAGAAGCAACGTCTCACGTTCCTCGAATGTCCCA
ATGAGCTCGAGGCGATGGTGGACATTGCAAAGGTTGCCGACATTGTCCTTCTGATGATCGACGGAAACTATGGGTTCGAA
ATGGAGACGATGGAATTTCTCAACATTCTTGCGGCGACTGGTATGCCTGGAAACGTGTTTGGGATCCTCACGCACCTCGA
TCTCTTTCGCAAACCGCAGGCGCTCAAGGACGCCAAAAAGAGGTTGAAGCATCGTCTGTGGAACGAGCTCTACCAAGGGG
CACATTTGTTCTATCTCTCCGGAGTGATCAACGGCCGGTATCCAGACCGCGAGATTCACAATCTATCGCGCTTCCTTTCG
GTAATGAAGAGCCCGCGGCCATTGATCTGGAGAAACTCGCACCCGTACGCGGTGGTGGATAGCTTTCGCGATGTGACGCA
CCCGACGAAGATCGAGGAGGACGAGATGTGTGATCGGTCGGTGGTGTTCTCGGGCTACCTGCGCGGCACGAACTTTGCGG
CGCAAGGCCAACGAGTGCACATTCCCGGACTCGGCGACTACACGATCTCGAAGATGGAGGCGCTGCCTGATCCATGTCCG
ACTCCGGCCATGGAGCAGGCGATAGCCAAAGCGACAGGGAAGACGGGACGGCGGCGCCTAGACGAGAAGGACCGGAAGCT
GTATGCACCGATGTCGGACCGGAGCGGTCTCAAAATCGACGGCGATGCCATCTACATCTACCGCGAAAAGGGTTTTACAT
TCGACAAGGACGGCGGCGGGGACTACGAGCGCGGTGAAGGCGAGGAGCTGATCATGGGACTCCAGGGCGAAAGAAAGCTT
CTCGGTGAGACGGATCGGGGGATGCAGCTCTTTTCGAAGGGCAAGGAGGTACGAGAAGTGCTGGAGAACAACAATGGGCG
GAAGGAGCAACGCAAAGCGCGGGTGGCCGAAGTGGACGGTGGATCTGACGGAGAGGAGGGTGCGTTTGGAGAAGACGACG
GGTCTGAGGGCGAAAACGGGCCGGAAGACGATGCTGGGTCCGACGTTGAGACGGAGTTTGATGAGAAGAAACTCGGCAAG
ATGTTCCGGGATCGCGGTGACCGCGGCGGCGACAAGAAGGAAGATCTTGCCTTTGCGGACAGCGATTCTGACCTGGGGTC
ATTGTCGGGCGACGAGGAGGCAGAAGACGAGAGTGGAGACGACATTGAGGAAGACGATTTGGAGGAAGACGAGGTTGACG
AAGACGACTTCGACTCGGACGAAGAGGAGGCAGCAGTACGGTGGAAGGACAACATTGCAGAACGGGCAATGAGCCTGCAC
AAGCGGAAACGACCGTTCCAAGCAAAGGAGCTGGCAAGGATGATGTACGACAACGCGCTCCCAACAGCCCTGGTGGTAAA
ACGGTGGAGAGGAGAGGAGTCGGAGGAGAAGAAGGAGGACAAAGTCGGGGAGGGTGAGGCGGGCGAAGAGGACGAGTTCT
TTAAGAAGACGCAGACCAAGGAGGGCGAAGATGAGTCGGAAGACCGGGCGATTCCGCTGCTGGACTACGAGGCGCTTGCA
CAACAGTGGACAAGCGAAGCATTGGAGGCGCTGCGGCCCAGGTTTGCAACGGTGGTTAAGAAACGAGGTCGGGGTGGAGA
CGGCTCGTCAGACGAGGAGTTGGACGGAGAGGACGTTGAGGCAGACGAGGACGAAGAGGGAAGCGGATTTGTCGAGGAGG
ACGAGGGCGACGGGGCGTTTGAGGATTTGGAGACGGGCGAGAAGCACGGGCCGTCGTCGAAGAAGACGGAAGAGGCAGAG
TTTGAAGACGAGCGAGAGAAGAACGCACGACGGAAAGAGGAGCTGCGGCTGCGATTTGAGGAGGAGGACCGGGAAGGCGT
TCACAATGCCAAGGCGATGACGCGTAAAGAAGCCGGGACGACGGCAGATGAATTTGGGGAGGACGAGTGGTACGACGCGC
AGAAGTCGCTGATGCAGAAGCAACTGGACATCAACAAAGCAGAGTACGAGACGCTGGACGAGCGACAGCGGGTAGCAGTG
GAAGGACTGCGAGCGGGACAATACGCGCGAATGGTGGTGGAAGGGGTGCCAGCAGAGATGGTGCGGCTGTTCACTTCACG
GATGCCGCTGATTGTGGGAGGACTGACAGCGACTGAGGAACGGTTCGGGTTTGTGCAGGTGCGGATTAAACGGCACCGAT
GGCACAAACGGATTCTCAAGACGAATGACCCGCTGATCTTCTCGCTCGGATGGCGACGCTTCCAGTCGATGCCGGTGTAC
AGCATCTCGGACTCGCGGACGCGCAACCGGATGCTCAAGTACACGCCAGAACACATGCACTGCTTTGCGCAGTTTTACGG
GCCGTTTGTGGCGCCCAACACGGGCTTTGTGTGCTTCAAGTCGTTTGCGGCAGACGCGGTGGTGAACCAGCAAGGGCTGC
GGATCGCGGCGACGGGCACGGTGCTGAGCGTGGACGAGTCGACGGAGATTGTCAAGAAGCTCAAGCTGACAGGCACGCCG
TACAAGATCTTCAAGAACACGGCCTTTATCAAGGGCATGTTCGGATCGGCACTGGAGATTGCCAAGTTTGAGGGCGCAGC
CATTAAAACGGTCTCGGGCATTCGTGGCCAGATCAAGCACGCGCTCAAGCAGGAAGGCGCGTTCCGGGCGACGTTTGAGG
ACAAGATCCTGCTGAGCGACATTGTCTTTTTGCGGGCGTGGTATCCGGTGAAGCCGCGGCGGTTCTACAACCCGGTCACG
AACCTGATCGGCTGGCAGGCGATGCGGCTGACGGGTGAGCTGCGCCGCACGCTCAGCATTGCCACGCCACAGCAGCGCAA
CAGCCAGTATCGCAAGATCGAGCGGCAGGAGCGCCACTTTAACACGCTCAAGGTGCCGCGGCAGCTGGCGGCTTCGCTGC
CGTTCCGCCAGCAGATTGTGCGCACCAAGAAGCAGGGCCACAAGACGTACATGCAGAAGCGGGCGGTCGTGGTCGGCGGC
GAGGAGCGCCGTGTGCGCGACATGCTGCAGAAGCTGACGACCATCCGCAAGGACGTGTCGGCCAAGCGAGCCGTCAAGAA
GGAAGCCAACCGAGCGGAACATCGTCGCCAGCTGGCCGACGCGGCCGAGAAGCGGGCTGCCCGCGAGAAGCGCGAGACCA
AGGAGTTCTGGAGTCGCGAGGGCAAGAAGCGCATGGCCCAGGCTGACAGTGCTGGCGGGCATCGGGCGAAGCGAAGCAAG
AAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62