GenePrediction:GLEAN_6372 Details

Name: GLEAN_6372
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:550944..544921 (- strand)
Length: 6024
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:550944..550623 (- strand)
Length: 322
Type: CDS
Source: GLEAN
Position: GCSC_144:550542..550365 (- strand)
Length: 178
Type: CDS
Source: GLEAN
Position: GCSC_144:550297..544921 (- strand)
Length: 5377
>GLEAN_6372 class=GenePrediction position=GCSC_144:550944..544921 (- strand)
ATGGCTGATCCAAGCGCCCTGCTGGGCCATCACCAGCCGCCACAGCAGAACGGGTACCAGAACGGGATCGATCCAAGCGT
TCTCCTGCTCGACCCAAACCCCCCGTCATCTCGACTTGCTGCCTCTGAACCGCTCTCTGTCTCCATGTCGGCCGCGTCGT
CCTCCTCCGTTGCTTCACGACCGTCTCAGCCTCAACAGCGACCAGGTCAGCCGCAGCCGCCACCGTCTCTGGCAACTGGC
TCCCAGCGATTCAAGCGACCGTTTACCTTCTCTGAAGCTCTTCCATATTCACCATTCTCATCCATATCGCCTCTGGAAAC
AAGTATCTCTCTCTCCTCTCTCGCTTCTTACGTTCTCCCACGTCTTCATTCGTCGTCTTCTGACTTCATGCGCTCTCAAT
AGGAGTCATCCCCATTCCGACGCTCGCCTCCAAGGCTGCATCAACACCATTGGCGCAACTTGTTTCGCAGCAGGAATTCA
ACACCTTGAACAAGAACATCTCAGGCTCTTCCAGTCCCCCATCAGATCGCAATCTAGATGACATCTACCACCTCATCGCG
ACCAGCAAAACTCCACTTTTGTATGCCAGACTCCAATGATTTGGCTTACCATCATCGTTCTTCAGTGCGACTCTAACATG
TCTGCAGCAATTTCAAGCCCCTCCCTCAAACGACGACTCCTTCCAGCACTTCTGCATCATCCCCGACCACTCCTGGCCCT
GCAGAAAATCTTCTGCCTATTTCGAAAATGGTATTCAACAAAGCGGACATACCGTTCCGCTATCCCAGCCCCGAGTCTCC
GGGAGATCATACTGTAATCGGCAATGTCGACACAACGCCAAAGTCGGACTCGATACATGCAGCCTTGACGAAACCACCCC
CCAAGTCAAAGCCCGCAGTTTCTACAGCTTTTGGAGAGAGTCCTTCTGATGTCAGATCCTCCGCCGCCGCTATGCACAAT
GTGCAGTCTCACGCTCGCAACTCGACCAACTTTGTTATTAGCATACCCGCACACCCACAGTTGCCAGCAGCGAAGATCAA
GGCGCCTCAAAACCACAGCTTAGAAAGCTCTCTACCCGGGGCAAATGGAAACCAGCCACTAGCGTCTGCTCCGAGCAAGT
ATATGCTTTCCGGGGACCAAGAACCACTGGCACGGCCAGAGACGAATACCTCTGATATGGCAGCACCCAAGTCCAAACTG
ACGATCGCCTTGGCGCCTGCACCGAATTTCAACCCTCAGGAGTATCAGATGGTTGCGGACATCCCGGATGATAATGGCCA
GGAAGACTTTGGCGATTTAGACCAGCGACAGAGAGCAGACGCTGCTTTTCAAGAAATGCAGCGTCTATTTCAGAGCGTAT
TTGAGGCAGAGGCCAACATGACACAGCAGCCTTCCGCTGTGCCACTGATCACATGGACAAGCGATGAGGAGCCGACGTTG
ACTGATGCTGCTCTTAAAAAGGTCCAAGGCACCGTTCACAAAGCCATCACTCTCGGCTGTTTTGCGGATGTTCCTGTCGA
GGATCTCCTGCACATGCAGAGGTTGTGTGACGGTGTCTTGAGGCAAGCCGAAACCCTCGATCTCAAACTCAACAATGAAG
CTAGTGGATCTGAGATCGACGAATGGGTCGCTCAGTTGCGTTATGCAGATACGGGGCTCAAAGCAGCTCGTTTGTCGTTG
AAGATAATGTCCGGCGGACGAGAGGACAAACAACTCTACTCCGAGAATGTTATTCAGGCCTCTGTAGACTTGTTCAGAAA
TGTCATGGACAGCGTCATTGTGCCTATTGCCGAGTTGCGAAACTCTGGATCGACCGAGGCTCGGTTCAAGCAGCTAACCC
CATGGAAGAAGGCAATATCTCCCATCTTCACGGCTGCCCAGCGGCTTTTTTCTGGCATGACCTCCTTGGTCTCTGTCATT
GATCTGTCAGAGCTCGTTGTCAACTCGCTTGAATTTTCAGCCTCGTCTCTCATCTTTGTTGAAAACGCACATACTGAGCG
AGACTCGGTATTAGGCGTTCAAGCTTTTGACGGCCTCCGTCTGGCTGCCATGGATATGCTGTCCCAGATTTTCATCAAGA
TTCCTGCCCAACGACGTGGTATCTTTGACGACATCCTAACGTCCCTCGAGAAGCTTCCCATTGGAAAGCAGAGTGCCCGC
CAGTTCAAGCTGGCAGACGGCAGGAGTATACAGCCCGTGTCGGCGCTCATCATGAGGCTTATCCAAGCTAGCACTGGCCG
TGTGACCGAGAAAGCGAAGTCGACATCACAGATAATGGATGAAGAAATGAAAAATGATGACGATGACGACGAAGACACAG
ACCATGCGTCGCCCGTACATACCGCCACCATTGGGTCTGAAGAGGAAGCCGCCTATGAGCATGAGCTTTCCGTCAATGAG
CTGGCACGCGTCGCTTCTGCCCTCAATAGTACAGCGTACTATCACGCCAAATATGTCATCAATTTCATTGTTCAGCGAGC
ACAGACATCTTCCAAGTCAGCCGATACGCCGTACCGCAATCTTCTCGATCTCTTTGTTGAGGATTTCACAACATGTTTGG
AAACACCTGACTGGCCTGCTGCCGAGCTTCTTCTTCGGCTGCTCATGCTGTCAATGTTCAAGTTGACCGAAGGCGACAAG
ATCCCTGCTCCGGTCAAAAACATGGCTTTGGAGGAATTGGGCGCTATAGGAGCTGTTCTCGCGCGGTTGCGCTCAACTGT
CAATAAGTCAGCCAACTCGCCCGAGACCACGGGCCCCGAAGAGCTAGACCACCTCTTGTCGAATCTATCGGCGGCGGCTC
TCGCAGAAATGCCACCAGCGGAAGAGTTTCTGTCCTGGACCGGACCTTTTAGATCCACCCTGGAATACCTCGGGGACAGG
AGCTCTCAGGACCCTCATCTGTGGAGTGCCATATCATATGTGGTAGCCGATTGGTCGGGGCGCGTCTGCAGGCTGTACAC
AGCACGCTTACAAGCAGCCGCTGCCATGGTGGTTACCGACGAAGATGCGGACGGCAAGAGTTGTGGCAACCGCGTTCAAG
AGAGACAGAACAGGGAATTGGGGCGGATCGCATACCGGCTCCGTGTCATGATCGAGGATGGGCGAGGCTTATCCGGTACC
CGCTGCTTCCGAGCGATTTCTGCTTCTCAAGCCAAACTGTCTTACGCAATTGTCACGCTGCGCTCGTCGCTTGGTGGATC
TTTCAATGATGTTATCAACATCTTGGCCATGGGCATGCGCAGCGATCAGGCCACGGTCCGGAGCAAGAGTCTTCGAAGCA
TCACGGAAGTGCTGGAAATCGACCCTACCATCTTCGACAATCCGGCTTCGGTCATTGGCAGGCTCATCAGAGAGTGCTGT
GCTGACTCGTCCGTTCAGGTGAGAGATTCTGCACTCGGCCTCGTCAGTCGCGCCATTACGCTGCGACCCAACCTGGAGGA
GACCATGATCAAGACAATCATCGACAGATTTATAGACTCGGGCGTAGGTGTGAGAAAGCGTGCCATCAAGGTATCCCGGG
ATGTGTACTTGCGCAACCAGTCCAGGGAAATCCGGAGCGACATAGCCAATGGTCTACTTCACCGTATCCAGGACCCCGAC
GAAGGTGTGCGGGAGTTGGCCCGACAGACCATTGAGGAAGTTTGGGTCACTCCTTTCGCCGAGACACCGGCATCGGTTGC
AGGAGGACTGGACACTACCGCGAACAGGACGTCGTTGACAGACCATGTCGGCTTGATCCTGCAGACAGTCAGGACGGGAA
CTGTGACGCCTATTTTGGACAAGGTTTTCCAGGCAATTCTCTCACCCAATGCCAAAGCCGCGGCCACAAATTTTGGCGTC
TGCAAACGCATAGTGGCCATCATGTGCGACCTCATCGACAATCCTGACACCGACGACCCATCAACACCATCTGGACGCGA
CGCCCTGCAGCTGATGATGATATTTGCCAAAGCGGACCCGCGGCTGTTCACCTTTGAACAGATTCGCCTTTTGAAGCCAC
ATATCGCCAGCGTCAAGGATATCAATACTGCCGACGACATGGCTGTAGCCAGAGCAGTCGTGGTCATCTACCAGCGTGTT
CTCCCTCAATTGCCCAGTGTTTTGAAGCCCTTCCTGGAAGAGGTTCGCGTTAGCCTGATGCAGAGTGTGCCCAAAGTCAG
CAGAACACTACTCGACGATACTATGGGCTGCCTTTGGGTGATTAGCGTTCTGCTCAAGGATCTGGATGGCCTTGGTCGCA
TTGTTGTGTCTGCTCTACAGGGCATGCTGAAGGAACAGCTGCTATCCGAAAAAGATCCGCTGTTTGAGAAGAAGGCCATC
AGGTTCTCCCGGTACGCACTGATCGTCGGCATGGCTGGGAAGCACTGCGACCTAGATAGTGGGATGGAAAAGTTCAAGGC
CCAGTTTCCAAAGTACGGTGTCACGTCCGTCTCCAAGCTAATGGTGGACGTTCTCTGTCCATTTTCGATGCCCCCATGGC
CCCTGGCCATCCGAAGGACGGCCTTGGATGCCATTGGTCTCATTTGCCAGTCTTGGCCGCGCAATTTCGTCTTGAAAAAC
ATATGCACAGCTTTTCAAACCGCCTTTAGCCAGCACGATCCCAGCTTGGAAGTCAAGATCATGCAGTCTCTGAAAGAGTT
TCTGACGAAAGAAGAGCAAAGGTCAGAGACAGCTTCAGGTTCTGCAAAGGCAGCAAATGGTGGCAGCGGAGAGAGCTCCA
AAGCGGCCCGTACAGGAGATGGGCCTGATAAGAAGAGGCAACTGACAGTTATGGGAGGCACAAACCACGATGATGTCGCC
AGCGCGACGACCCAGAGGTTCCTCAGTGACATCACGAGGATTGCGTTGGGCTCTGTCAGCGAGGAAGCCTATCTTGCTGC
GGAGATCCTTGGGAGCATCAGCCGACAGGGTCTCGTCCACCCCAAAGAAACGGGTGTGACGATGATTACACTGGAGACAT
CGACAATGCCGAAGATGGCCGAACTAGCTTTCCGGGAGCATCGCGCACTACACAACAAGTACGAGACAGTTCTGGAGCGA
GAGTACATTAAGGCCCTTCTCACAGCATATCAGTTTCAGCGAGACGTGATCCACGACGTTCGTGGAGCGACTGTAGAACC
TTTCACGTCTAAGCTGCACCATCTCATGGATGTGGTCAAGGACAGCAAGTCGAAGAACCGCAGCCGGCTCCTGGAGAAAA
TGTGTGGGCAAGTGGACTTTGAGCCGGGGAAGTTGGACGTGTCCAAACCGATGCCAAACCACCTCGAATTTTCACGCTTC
GTGGTGGAGAACCTAGCTTACTTCGAGTATGTCACAGTGGGCGAGCTCCAGACAACTGTGGCAACGATGGAGAGGCTGGT
GCACACGACTGGAGTCTCGATTTCCCAGGCCATCGAGTCGGACATTTTCGAGTCAGCCGATGACCGAAAGAACGTGACGG
CTCCGATCGTTATGATTGGGAGTGGCGAAGAGCATGTCGAACCGTCCGGCCTTCCTTTAGGCCCTGCTCTGCGACACCCT
ATCAACGTCCTCCGTCTGCGACAGTTGGCCACGGGGTGCATGGTTCTCCTCTGTGTATGGGAAGCCCGGAGCTACCTATG
CCGCCAGTACGGACTCAAACGCGACAGCAACAAGGCCAAAGGGCAGTCTCGAGACTTGACGCGGGCTCCCAGCAAAGTGC
AGGGCATCACGGGTGAAAAGTTTTGGGACGAGACGAGTACAATTATGAAGGGTCTCGACTCGCAGGAGCTCATGGTAGCA
CGCTGCAGCAGCTTGGTAGAGCTCCTGACGGTGGACTCGGAGTTCAAGCTGGAAGGCGAGGACATGAACGAAGACCCGAC
AACGCCAACGGGAATGGAAGACGACGACGATCAAGACCGCGGCCGAAAGCGGAAGGCAGGTGGCAACACTCCTGGCGGGC
GGAAGAAGCGGCAAAGGTCCAACTCGCAGCGGCGAAAGCGAGGCAGACCGCGGAAGAACGCTGAGGTTGGAGATGAGGAC
GACGGTGAATTTGATGCATTTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62