GenePrediction:GLEAN_6375 Details

Name: GLEAN_6375
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:518910..518409 (- strand)
Length: 502
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:518910..518870 (- strand)
Length: 41
Type: CDS
Source: GLEAN
Position: GCSC_144:518789..518642 (- strand)
Length: 148
Type: CDS
Source: GLEAN
Position: GCSC_144:518555..518409 (- strand)
Length: 147
>GLEAN_6375 class=GenePrediction position=GCSC_144:518910..518409 (- strand)
ATGGCCACACCATCTTTCTACGAGCTCTACCGCCGGAGCAGGTAATTCTCTCCGCCCATGCGCGTCTGCGCCTTTGTGTG
CGGATCTGACCATGGCCTTCTCGGTCTCCTTGTCTGTATAGCATCGGGTATGCCCTGACCGACACGCTCGATGAGCTCAT
CCGCGAGAACCGCATCGATCCGCAGCTGGCCATGAAAGTGCTCCAGAACTTCGACCGCGCCATCGCCGAGACGCTCCAGG
AGAAGGTCAAAGCTCGCCTGTCCTTCAAGGTGAGATGCGCCAGTTCGAGATAATGCCAGAATACAGAGACGTCCTAGAGA
AAGGGAAGATGGATCGTGCGCTGATGCAATAACAGGGATCTCTGGATACCTACCGCTTCTGTGACGAGGTCTGGACGTTC
CTTATACGCGACGTGCAATTCAAAATGGAAGGCGGAGGGGCACCGGTTTTTGTAGACAAGGTCAAGATTGTCAGCTGCAA
CGCGAAGCCAGCTGTTCCGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62