GenePrediction:GLEAN_6377 Details

Name: GLEAN_6377
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:504325..503717 (- strand)
Length: 609
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:504325..504323 (- strand)
Length: 3
Type: CDS
Source: GLEAN
Position: GCSC_144:504249..504230 (- strand)
Length: 20
Type: CDS
Source: GLEAN
Position: GCSC_144:504065..503883 (- strand)
Length: 183
Type: CDS
Source: GLEAN
Position: GCSC_144:503780..503717 (- strand)
Length: 64
>GLEAN_6377 class=GenePrediction position=GCSC_144:504325..503717 (- strand)
ATGGTACGATGCAATATCTTGCAACTCTCCTGTCGCCGCGTATGATCTGAACAACTGCTGACTGTCTTTCCTCCAGGGTG
GTGGTCCGAAGATCCCGTAAGACATTTTCCTTCCCTTCCATCCGGATTCGCAATGGGCTCGATACTCGGCGCAGCGACAG
CGGACTGCTGGCTCATTGTTGACTGCGAATCTACTCAGTCCCGGCGACAGACGACGCTCAGCACAGATTGCACGCGAGCC
CGCAGCTAACGACGATCTAGGTACCCGAAGCATGTCTGGTCGCCTTCTGGCGGCTGGTACGCACAGCCAGCCAACTGGAA
GCGCAACACGGCCATTGCTGGCGTTGCCGTGTTCGCCATAACCGCAGTCGTCTGGAAGATTGACGGCGAGCTGGAGTACC
GGAGCAAGATGCCCGAGCCAGGACGTTTCTTCCCCAGCAGATAGTATGTTTCGCGAGCGAGGGCGACCAGATCCCGAGCA
ATCTGGGCAGAGCACGACACCGTGCACTGTGGCGAAACGTTTCAGTCTTGCTAACAATACCCCAGCTGGAGCAAGCAGAT
CATCGAGTACGAGAAGGAGCAAAAGGCACTACAACAACAAAACAAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62