GenePrediction:GLEAN_6378 Details

Name: GLEAN_6378
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:503124..499046 (- strand)
Length: 4079
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:503124..503102 (- strand)
Length: 23
Type: CDS
Source: GLEAN
Position: GCSC_144:502970..502726 (- strand)
Length: 245
Type: CDS
Source: GLEAN
Position: GCSC_144:502031..501678 (- strand)
Length: 354
Type: CDS
Source: GLEAN
Position: GCSC_144:501530..501082 (- strand)
Length: 449
Type: CDS
Source: GLEAN
Position: GCSC_144:500107..499046 (- strand)
Length: 1062
>GLEAN_6378 class=GenePrediction position=GCSC_144:503124..499046 (- strand)
ATGTTCTGCGGCTGGTTGGACCAGTGAGTGTGCTGCGTTGCCCTACACTGCCAGCGGTAATGTCCGTTGCAGCCGGTGTT
TGCCATGTAGATCGGAAACGTCGTACTCGTACGGAGCAGCTGCTTGGGTCGTTTATACGTCGTACGCTCGTCAGAGCGAC
GGGGACGCCAACCCGGCGAGCAGGCAAGCCACCAGGCGCCAAAAGGTTCAGGCAGGTCCCAGGGCCCACAGCAGCAGCAG
TGCACGCACACAGCGCCAACAGCGCCAAGGTCGCCAAGATCGCCAAGGTTGTCAGAAAAGGCGCTGGCCGGGGAGTTGCT
CGGAGGTATTGCCGCCATGGCAGTCCGCCACAGCTGGCAAAGTCCGTCCGGGCGACCGCTGGCTGCTGGTCAGCACGGAG
TGTGCGGCGGGAGACAGCGTGCCGTCCTTCCCCGTCGCCTTCCCTTTTCTTTTTCTTTTCCTTTTCCTTTTTTTTTTCGC
CGCCCTTCTGCCAGTACGAGGGCATGTCTCTGGGCGATGCTGATTGGCTGGCTGCCAGCTGAACGACAGAGATGCAGAGT
TGTGTTCAGGTCCCGTGATCTATTATACTTGTGCTGGCTTCTGATTGGCCGAGGTGGAACAGGGGTTCCTTGCACTACTA
AAAATGGTCTTCCCACTCGCCAATATTAGTAGTTCAGCCGAGCAGTGATCTTATTAATCATCAGGCGTCTAAAGCGCTCG
TAAGACAAATAGGACGGCAGTACGAGGCCTGTCGCAAGATACGAAGCCAGATTTAGCGGGAGCTAAAAAAGGGCCAGGCG
AAGAAGAAGAGCCCGCAGCCGTGCTCGGCCTGTTTGCGAGGGAAAAAAAACGCCAGAAGAAAATGACGACAAGGGGCTAT
AAATAGGCATCTACAAGACAATTTACGAGCATTTTTAACGTTTAGCTCTAACGCTTTTCAGCTATTCGCGGCCTTCTTTT
CTTCTATGCCCCCATCTCAACTCGTTTCTCCAGCCCTCGGAATTTCTATACGACCCTACGCTACCCTCTTTGGGTCGTAC
TTGTCCATAGGTGTGTTTTTAAGTTGATAAACCCTTGTGCTACGACCTAATAGTCCGTCTCACGGACCGCCCCTATCGTA
TCCCTCTGTGCCCCTGTGTGCTGGAGGCTTTGCGCGTCTTTGCCATGCCACCCGACCAGATGGTAATGCGGACTCGTATC
CTTCTATCCATCAGCTCTGCTGCAGCACACTTCTCCGGAAGGGGCAGCATCTCCGCACTCCAGCGCCTCGCTCTCACCGA
CGCTCTCGAGCGCCGAGATGGCTGGGGAGAAAGGGGGGAGCGCAGTCCGATCGCAGATGATAGGCAGGCCTGCCGGCTCA
CGTGCGCCGTCCCACGCCACAGCCGCCTCTGCTCTGACTCGTCGGATCCCGAACAGAGCCGGGCCTGTTTATACGACGTG
CTACTATGTATGTACACCATCGACGATGGGACCCCACCGCTTCTTACCGTTTCTGTCAGCCTCCCGTTTCGTTTCGTTTC
GTTTCGTCGAGCTCGTGCCCCCAGCCTCACTGCCAGCCCTGGGGCTCGTATACGTACATAGTATCTTAGCATAGCAATAT
GGCCGAACCGCATGCGGAGTCGTCCCCTCCCCTTTGTGGCAACCGGACGGGGACAGCACCGCCACCCTGACGCCGTTGTG
GCCTGGCCCGGGGTCATCAAGGGTCTGTGGGTGTGCGGACGGGGGGGTCGGAGCCGATCAGATGGGGCACAGGAGCTCAA
GCGAGAGGCTGGGACTTTCTCGTTTCGGACAGGCGTCGCTCTCTCGTCGTTGCCCGAGGCTCGTTTGTGCCAGAGCAGGC
CGCCAGGTCGTCCCACCGTGACGGGTATCACCCAGCGCATCGTGCCGGCTGCAGCAATGGCTTGGGGGCTTGGACGGCTC
GATGGCCCGAATCGGCTGTCGGATAGCCGAGCATCTCCCCACGACCAGAGAGAAGGGTCTGCTCTGCAACCACATCGCCT
TGCAGGACTAGTGCCAGCCAGTAGTGACGTTGGCGAGAGAGAGGTACGAGGACATCGTAAGCGGCATATTTCTTCTTCTT
GCCCTCTCTTTCTTTCCTCCCCCCCCCCCACGTCTTTTTTTTTCTTCCCCCTTTCCTTTTTTTGTCCTCCTCCCATGCTC
TCCTTGTCGTCCCACTCCCAGTCCCTCCCTCGGTTTTGCTGCGGCTCGCCTCTTCGTATTCTGGGCAGCCAGTCGCTAGG
TTGCCGTGGCCCATGCCCACCTTGCATGATGATCAACTGGCCCGCATTGACTCTCCCGTACACACGGCCCTATACCTCGC
GGCTGATCAGCCCTACTATTTGATTCTGGCACAGTCCTCTCCCTTGTGCCCCAATCAGAGTCGAATGATACAGCACTATC
AAGGGCCTTGCTGTGGCCCTCACAAACTCAACCTCCCGTGGAAAAGCCTGGTCGTGGTCTTGCTACCCTCGCCGTCCTAC
TTATAGTTCCTCCTCCCTGCCCACTTTCCTCGCCCTCCTCTCCTCCACTCACCGTCGCTCGTTATATCAAGAAGGGGTGG
CAAATGTGTTGACGCGCCTTCCCACAGCCTCTCTCTCTCTCACCCCGACTCCTTGTCCGATACCCATGGCAGCAAAAGAC
CGAAAGACCTAAGATGCCAGCACAAGACAGAAGCCGGTAGCATGCCATTCTGAGCTCCTCACACTCGCTAACACCACCAC
ACACACTCGCTTACCCATTCATTCGTTCTGTGGAGTTTCACTGCTTGTGCAGGATCCAGTCCACACCAAACTCCCTCCAT
CATTCGCTTACATCCACCGACTGGCAAACATCCTCTCGTTATATCTTCCGTCGATCACCATCTGACCGCATCATCTACGA
CGTATAATACAATGGCCCCCCAAACCGTAAGTCTCCAGGTCTGCCATCTCCCCTTCTCTTTGTTTTTCCCCATTCATCCT
TTTTTTTCCCGTTTCACCCAGTGTTCTTCCTGCTCATGACCTTTTGTCGACCTGCAGGATGAAGCGAATCTCGCTCGAAT
CCGCGACAACCAGCGTCGCTCTCGTGCCCGCCGCAAAGAGTACCAACAGGAGCTCGAGCAGCGCGTGCGCACGTACGAAG
AACAGGGCATCGAGGCCTCCACCGAAGTACAGCAGGCCGCCCGCCATGTGTCTGAAGAGAACCGCCGGCTGCGGACCTTG
CTTCACCACCACGGTGTCCCCAACAGCGAGATCGAGGCTTACCTCCTCAGCGGTAAGGTGTCTGCCCTGGGCACCACACA
TCCGGCAGCAGCCGGAATCCCGCCTCCCGGCTCGTCAGCAGAGGGACCGCGAGTCCAGGCCCTGGAGCAGGTTCTGGTGC
CTCGCAAGCCCCTCCACTTCGGCACCACATCGCCGGGCACTAGCAGTCCTGCCGGCGAGGGCCGAGAAGCGTCTGTCCCT
CCGCTGTCGTCGTCATCATCGTCGTCGACCTTTGTAGCGGCGGCACGCACCGGTGGCAGCAGCAGCGTTGGCAGCGGACG
CCAGAGCTACCAGAGCCCCGGCACAGACCAGGGCAAGAACACGGTCGCAGCACTGCCGCAGCAGACGGCAGCTGTGGCCA
CATCCACCGAGGGCGACTATACCAGCAGCTACAGAGGTGACTTTCTCTCCACGGGGCCGTACAGCTTGGCTCCCGGCCGC
GCTGCAACCCCTTCCACTGCCGGCATGGCCTTCTATGGCCTCGATGGCGCCAGCACCGAGGATCTGCAGTATTCCGGATC
ACCAGCCTTTTTCGACTATAGCGTCTCGCCCCCATATCTCGGCCCTTCTACCTACGACCAACAACACCAGCAGCAACAAC
ACCAGCAACAACACCTACCACACCCACACCCACACCACCAACAACAACCACAACATCGACGAGGTGGAGACCACGAGGGC
GGGATGGGTGCGACCTCCGCCCCCCAGGCACACCCATTTTACAGCGGCGTCCAGGATGCTGCGACAGGAGAGACGTATAT
GCGGTCCTGCCCAGCGTGCATGTCCGGTTTGGGCTGTCAGGTCCACGGCACGTACTACGGAGCCATAGGAGGAGAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62